Effective Protective Immunity to Yersinia pestis Infection Conferred by DNA Vaccine Coding for Derivatives of the F1 Capsular Antigen
Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Ness-Ziona 74100, Israel/, http://www.100md.com
Received 8 August 2002/ Returned for modification 3 September 2002/ Accepted 23 September 2002/, http://www.100md.com
ABSTRACT/, http://www.100md.com
Three plasmids expressing derivatives of the Yersinia pestis capsular F1 antigen were evaluated for their potential as DNA vaccines. These included plasmids expressing the full-length F1, F1 devoid of its putative signal peptide (deF1), and F1 fused to the signal-bearing E3 polypeptide of Semliki Forest virus (E3/F1). Expression of these derivatives in transfected HEK293 cells revealed that deF1 is expressed in the cytosol, E3/F1 is targeted to the secretory cisternae, and the nonmodified F1 is rapidly eliminated from the cell. Intramuscular vaccination of mice with these plasmids revealed that the vector expressing deF1 was the most effective in eliciting anti-F1 antibodies. This response was not limited to specific mouse strains or to the mode of DNA administration, though gene gun-mediated vaccination was by far more effective than intramuscular needle injection. Vaccination of mice with deF1 DNA conferred protection against subcutaneous infection with the virulent Y. pestis Kimberley53 strain, even at challenge amounts as high as 4,000 50% lethal doses. Antibodies appear to play a major role in mediating this protection, as demonstrated by passive transfer of anti-deF1 DNA antiserum. Taken together, these observations indicate that a tailored genetic vaccine based on a bacterial protein can be used to confer protection against plague in mice without resorting to regimens involving the use of purified proteins.
INTRODUCTION7j][(s, 百拇医药
Yersinia pestis, the causative agent of plague, still represents a serious public health threat in various regions of the world and at the same time is gaining attention as a potential agent in bioterrorism. Even though live and killed whole-cell vaccines are available for human use, serious drawbacks limit their use for prevention of natural or human-inflicted outbreaks (22, 23, 39). Two Y. pestis proteins, F1 and V, are known to be effective immunogens and have been proposed as candidates for a combined subunit vaccine against plague (2, 38).7j][(s, 百拇医药
The fraction 1 capsular protein (F1), which is encoded by the 100-kb pFra plasmid, forms a large gel-like capsule containing multimeric F1 aggregates (7). The F1 gene was found to code for a 17.5-kDa polypeptide carrying a putative secretion signal (16). F1 is considered an important but not essential virulence factor unique to Y. pestis (12, 37). Deletion of the F1 gene does not abolish virulence but leads to a delay in onset of the disease in animal models.
F1 appears to have a role in blocking uptake by macrophages (13), yet its exact function in this respect is not clear. Interestingly, the structural gene of F1 has been shown to be homologous to interleukin 1ß (IL-1ß) and has been suggested to interact with IL-1 receptors (1). Such interactions may indicate that F1 participates in early stages of plague development and regulates the contact of the bacteria with the host. This could explain the high efficiency of anti-F1 antibodies in blocking infection.{z'$*, http://www.100md.com
F1 is an extremely immunogenic protein in both animals and humans. Immunization with multiple doses of F1 has been shown to protect mice against subcutaneous challenge with wild-type Y. pestis (3, 38), and a combined formulation containing F1 and V antigen confers protection against airborne infection (39). The protein has been associated with elicitation of protective immune response in humans as well (24). Hyperimmune sera from F1-immunized volunteers possessed F1 antibodies that can passively protect mice from virulent plague challenge.
The observation that genetic immunization is able to elicit protective immunity (33) has fostered the development of a new generation of vaccines. DNA vaccines provide prolonged antigen expression, leading to amplification of the immune response, and appear to offer certain advantages, such as ease of construction, low cost of mass production, high levels of temperature stability, and the ability to elicit both humoral and cell-mediated immune responses (for recent reviews, see references 20 and 26). The endogenous expression of antigen from DNA introduced into host cells leads to peptide presentation with the major histocompatibility complex class I (MHC-I), which is ideal for induction of cytotoxic T-cell response. Therefore, DNA vaccines have been primarily considered for use against intracellular pathogens such as viruses (18, 27). Nevertheless, the observed ability of DNA vaccines to elicit both cell-mediated and humoral immune responses paved the way for their assessment as expressers of soluble, secreted bacterial antigens, conferring immunity presumably by eliciting the classical MHC-II-mediated humoral response. The efficacy of such DNA vaccines was found to vary from case to case and depended on the nature of the individual antigen, on the vaccination mode (15), and on the subcellular location in which the antigen was expressed (8, 32, 36).
In a previous attempt to develop genetic vaccination against Y. pestis by using F1 DNA, it was found that outbred mice were nonresponsive and inbred mice gave a weak anamnestic response (9). The advances in genetic vaccination and the accumulating information on factors that modulate the extent of response to DNA vaccines led us to reexamine genetic vaccination based on F1 antigen.3tu^;-, http://www.100md.com
In this report, we compare three F1 DNA derivatives carrying different signals for cellular localization and demonstrate that one such genetic derivative, which presumably targets expression to the cytosol, induces an effective antibody response and confers protection against high doses of infective Y. pestis.3tu^;-, http://www.100md.com
MATERIALS AND METHODS3tu^;-, http://www.100md.com
Cloning of F1 derivatives and construction of expression plasmids. All constructs are based on the eukaryotic expression vector pCI (Promega), which carries the efficient eukaryotic cytomegalovirus promoter, a recombinant chimeric intron, the prokaryotic T7 promoter, the late simian virus 40 polyadenylation signal, and an ampicillin resistance marker.
The Y. pestis caf1 gene was cloned by PCR from the DNA of the virulent strain Kimberley53. For cloning of the full-length F1 gene, primers nF1 (ACTGCAGTCCACCCACCATGAAAATCAGTTCCGTTATCGCC) and cF1 (TCATCGGCGGCCGCCTATTATTGGTTAGATACGGTTACGG) were used. To generate an F1 derivative (deF1) lacking the putative bacterial signal peptide (16), primers nF2 (ACTGCAGTCCACCCACC ATGGCAGATTTAACTGCAAGCACC) and cF1 were used. The two resulting PCR products were digested by SalI and NotI and ligated to pCI plasmid linearized by the same restriction enzymes, yielding the pCI-F1 and pCI-deF1 expression vectors.o, 百拇医药
The Semliki Forest virus (SFV) E3-Y. pestis F1 fusion protein product (E3/F1) was generated as follows. The SFV E3 gene (198 bp, coding for 66 amino acids) was derived from a plasmid carrying SFV DNA (17, 19) as a PCR product using primers nE (CTCACAAAGCTAGCCACCATGTCCGCCC CGCTGATTACTG) and cE (CTCACGAATTCGGAGGCCTCCGGTGTCTTGTT CCGTTTCG). This fragment was then inserted into pCI between the NheI and StuI sites. The F1 sequence was inserted between the StuI and SalI sites to obtain pCI-E3/F1. All recombinant plasmids were verified by restriction enzyme analysis and sequencing.
In vitro translation of F1 derivatives. The coupled reticulocyte lysate in vitro transcription and translation system (TNT; Promega) was used as recommended by the manufacturer to generate 35S-labeled F1 derivatives. Translocation of the newly formed, labeled polypeptides into membranal fractions was examined by adding canine microsomes (Promega). Where indicated, translation products were treated with proteinase K (0.2 mg/ml; Sigma) for 15 min at 4°C in the presence or absence of 1% Triton X-100. The in vitro translated proteins were resolved by sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gel electrophoresis (PAGE). Gels were fixed in 10% acetic acid-30% methanol for 12 h, soaked in Enhance solution (Du Pont) for 30 min, washed in water for 30 min, and dried on Whatman 3MM filter paper at 80°C. Gels were then exposed to Kodak X-Omat AR film at -70°C for the indicated times. 14C-labeled protein molecular weight (MW) markers (Rainbow High MW; Amersham) were included as protein size markers.
Transfection and visualization of expressed antigens. For visualization by immunofluorescence staining, recombinant plasmids were used to transiently transfect HEK293 cells (34) in individual wells of a Permonax chamber slide system (Nunc International) in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. At 24 h posttransfection, cells were fixed with acetone for 20 min at -20°C. The fixed cells were incubated with polyclonal rabbit anti-F1 antibodies (1:1,000 dilution) for 60 min, washed three times, and treated for 60 min with goat anti-rabbit antibodies conjugated to fluorescein isothiocyanate (Sigma). Immunolabeled cells were viewed with a Zeiss fluorescence microscope.i;, http://www.100md.com
For visualization by Western immunoblotting, transiently transfected HEK293 cells were detached, washed with phosphate-buffered saline (PBS), and resuspended in 0.025 M Tris, pH 8.0. Cells were disrupted by three rounds of freeze-thaw. Following centrifugation at 14,000 rpm in an Eppendorf microcentrifuge, cleared lysates were collected. Cell extracts were stored at -20°C until further use. Ten-microliter aliquots were resolved by SDS-12.5% PAGE and electroblotted onto nitrocellulose membranes. Blots were probed for 60 min with rabbit polyclonal anti-F1 antiserum (1/1,000 dilution in skimmed milk) followed by a 60-min incubation with horseradish peroxidase-conjugated goat anti-rabbit antibody (diluted 1/2,000; Sigma). Bound peroxidase was visualized by chemiluminescence (Pierce SuperSignal kit).
Metabolic labeling and immunoprecipitation. Metabolic labeling of HEK293 cells was performed essentially as described previously (21). Twenty-four hours posttransfection, cells were washed with fresh medium without methionine and incubated in the same medium for an additional 1 h. Medium containing [35S]methionine (0.8 to 1 mCi/ml) (Easytag; NEN) was then added for labeling for 1 h at 37°C. Cells were washed once with PBS and then chased at 37°C with medium containing nonlabeled methionine and 100 U of aprotinin (Sigma)/ml. At various chase periods, culture medium was collected and washed cells were lysed with PBS containing 0.5% Nonidet P-40, freshly prepared 0.2 M iodoacetamide, and 100 U of aprotinin/ml. Cleared lysates were generated by centrifugation at 14,000 rpm in an Eppendorf microcentrifuge for 10 min.twn, 百拇医药
Extracts of transfected cells were immunoprecipitated with rabbit polyclonal anti-F1 antibody and protein A-Sepharose. The labeled immunoprecipitated proteins were analyzed by SDS-PAGE followed by fluorography.
Preparation of plasmid DNA for immunization. The Endofree plasmid preparation kit (Qiagen Ltd., Hilden, Germany) was used for preparation of plasmid DNA stocks. Alternatively, large-scale production of plasmid DNA was performed by the alkali lysis method followed by CsCl gradient centrifugation. The concentration of plasmid DNA was determined by measurement of optical density at 260 nm, and its purity was evaluated by calculation of the A260/A280 ratio (1.8). DNA size and homogeneity were determined by 1% agarose gel electrophoresis.&, 百拇医药
For needle injections, purified DNA preparations were solubilized in pyrogen-free saline (Mini-Plasco; B. Braun) to a concentration of 3 mg/ml and were kept frozen in aliquots at -20°C until use. For gene gun vaccination, plasmid stocks were resuspended at 1 mg/ml in distilled pyrogen-free water and stored at -20°C until use.&, 百拇医药
DNA preparations were examined for the presence of endotoxins by Limulus amebocyte lysate testing using a kit from BioWhittaker (Walkersville, Md.). Endotoxin levels in all preparations were found to be lower then 0.05 endotoxin units/ml, which is the detection limit of the kit.
Bacterial strain used for challenge. All challenge experiments were performed with the Y. pestis Kimberley53 strain. Kimberley53 was obtained by passage of the Kimberley strain (originating from Instituto Oswaldo Cruz, Rio de Janeiro, Brazil [5]) in mice (subcutaneous [s.c.] inoculation and harvesting from spleen).lq&.iy, http://www.100md.com
The SCLD50 of this strain in mice is as low as 1 CFU. No difference in virulence was observed when ICR, BALB/c, and DBA/2 mice were tested. Bacteria for challenge were grown for 48 h at 28°C on brain heart infusion agar plates (Difco).lq&.iy, http://www.100md.com
Immunization and challenge with Y. pestis. The female outbred ICR mice and inbred BALB/c and DBA/2 mice (5 to 6 weeks old) used for vaccination were handled in accordance with the National Institute of Health's guide for the care and use of laboratory animals and the guidelines of the local commission for animal care.lq&.iy, http://www.100md.com
For DNA immunization by needle injections, a protocol of three or four immunizations at 2-week intervals was used. For each immunization, 200 µg of DNA was administered either into the tibialis anterior muscles of the two hind legs or into the tail base dermis.
For gene gun immunization, plasmid DNA was precipitated onto 1-µm-diameter gold particles at a ratio of 2 µg per milligram of gold and loaded onto Gold-Coat tubing as suggested by the manufacturer (Bio-Rad). Polyvinylpyrrolidone (MW, 360,000) was used as an adhesive at a concentration of 0.05 mg/ml. Agarose gel electrophoresis was used to determine the amount of DNA. Vaccination was carried out with three immunizations of 0.5 µg of DNA at 2-week intervals. Gene gun shots were directed into exposed abdominal dermis. At the indicated times, serum was collected in serum separator tubes (Microtainer tubes; Becton Dickinson). Antibody enzyme-linked immunosorbent assay (ELISA) titers were determined as described below. Immunized mice were challenged by s.c. injection of the indicated amounts of Y. pestis Kimberley53 strain suspension (0.1 ml). Animals were monitored daily for survival for a period of 3 weeks.0[v9u, http://www.100md.com
Passive immunization of mice was performed by transfer of serum derived from DNA-immunized mice or from mice immunized with F1 protein (see below). Antiserum aliquots of 1 ml per mouse were injected intraperitoneally (i.p.). Blood was withdrawn from the tail vein 10 h after transfer, and the levels of anti-F1 antibodies in the circulation were determined. Three hours later, the passively immunized mice were challenged with Y. pestis as described above.0[v9u, http://www.100md.com
Generation of purified F1 antigen and anti-F1 antisera. F1 antigen was extracted from Y. pestis EV76 (5) and purified by the method described by Baker and coworkers (4) to an estimated purity of(Haim Grosfeld Sara Cohen Tamar Bino Yehuda Flashner Raphael Ber Emanuelle Mamroud Chanoch Kronman Av)
Received 8 August 2002/ Returned for modification 3 September 2002/ Accepted 23 September 2002/, http://www.100md.com
ABSTRACT/, http://www.100md.com
Three plasmids expressing derivatives of the Yersinia pestis capsular F1 antigen were evaluated for their potential as DNA vaccines. These included plasmids expressing the full-length F1, F1 devoid of its putative signal peptide (deF1), and F1 fused to the signal-bearing E3 polypeptide of Semliki Forest virus (E3/F1). Expression of these derivatives in transfected HEK293 cells revealed that deF1 is expressed in the cytosol, E3/F1 is targeted to the secretory cisternae, and the nonmodified F1 is rapidly eliminated from the cell. Intramuscular vaccination of mice with these plasmids revealed that the vector expressing deF1 was the most effective in eliciting anti-F1 antibodies. This response was not limited to specific mouse strains or to the mode of DNA administration, though gene gun-mediated vaccination was by far more effective than intramuscular needle injection. Vaccination of mice with deF1 DNA conferred protection against subcutaneous infection with the virulent Y. pestis Kimberley53 strain, even at challenge amounts as high as 4,000 50% lethal doses. Antibodies appear to play a major role in mediating this protection, as demonstrated by passive transfer of anti-deF1 DNA antiserum. Taken together, these observations indicate that a tailored genetic vaccine based on a bacterial protein can be used to confer protection against plague in mice without resorting to regimens involving the use of purified proteins.
INTRODUCTION7j][(s, 百拇医药
Yersinia pestis, the causative agent of plague, still represents a serious public health threat in various regions of the world and at the same time is gaining attention as a potential agent in bioterrorism. Even though live and killed whole-cell vaccines are available for human use, serious drawbacks limit their use for prevention of natural or human-inflicted outbreaks (22, 23, 39). Two Y. pestis proteins, F1 and V, are known to be effective immunogens and have been proposed as candidates for a combined subunit vaccine against plague (2, 38).7j][(s, 百拇医药
The fraction 1 capsular protein (F1), which is encoded by the 100-kb pFra plasmid, forms a large gel-like capsule containing multimeric F1 aggregates (7). The F1 gene was found to code for a 17.5-kDa polypeptide carrying a putative secretion signal (16). F1 is considered an important but not essential virulence factor unique to Y. pestis (12, 37). Deletion of the F1 gene does not abolish virulence but leads to a delay in onset of the disease in animal models.
F1 appears to have a role in blocking uptake by macrophages (13), yet its exact function in this respect is not clear. Interestingly, the structural gene of F1 has been shown to be homologous to interleukin 1ß (IL-1ß) and has been suggested to interact with IL-1 receptors (1). Such interactions may indicate that F1 participates in early stages of plague development and regulates the contact of the bacteria with the host. This could explain the high efficiency of anti-F1 antibodies in blocking infection.{z'$*, http://www.100md.com
F1 is an extremely immunogenic protein in both animals and humans. Immunization with multiple doses of F1 has been shown to protect mice against subcutaneous challenge with wild-type Y. pestis (3, 38), and a combined formulation containing F1 and V antigen confers protection against airborne infection (39). The protein has been associated with elicitation of protective immune response in humans as well (24). Hyperimmune sera from F1-immunized volunteers possessed F1 antibodies that can passively protect mice from virulent plague challenge.
The observation that genetic immunization is able to elicit protective immunity (33) has fostered the development of a new generation of vaccines. DNA vaccines provide prolonged antigen expression, leading to amplification of the immune response, and appear to offer certain advantages, such as ease of construction, low cost of mass production, high levels of temperature stability, and the ability to elicit both humoral and cell-mediated immune responses (for recent reviews, see references 20 and 26). The endogenous expression of antigen from DNA introduced into host cells leads to peptide presentation with the major histocompatibility complex class I (MHC-I), which is ideal for induction of cytotoxic T-cell response. Therefore, DNA vaccines have been primarily considered for use against intracellular pathogens such as viruses (18, 27). Nevertheless, the observed ability of DNA vaccines to elicit both cell-mediated and humoral immune responses paved the way for their assessment as expressers of soluble, secreted bacterial antigens, conferring immunity presumably by eliciting the classical MHC-II-mediated humoral response. The efficacy of such DNA vaccines was found to vary from case to case and depended on the nature of the individual antigen, on the vaccination mode (15), and on the subcellular location in which the antigen was expressed (8, 32, 36).
In a previous attempt to develop genetic vaccination against Y. pestis by using F1 DNA, it was found that outbred mice were nonresponsive and inbred mice gave a weak anamnestic response (9). The advances in genetic vaccination and the accumulating information on factors that modulate the extent of response to DNA vaccines led us to reexamine genetic vaccination based on F1 antigen.3tu^;-, http://www.100md.com
In this report, we compare three F1 DNA derivatives carrying different signals for cellular localization and demonstrate that one such genetic derivative, which presumably targets expression to the cytosol, induces an effective antibody response and confers protection against high doses of infective Y. pestis.3tu^;-, http://www.100md.com
MATERIALS AND METHODS3tu^;-, http://www.100md.com
Cloning of F1 derivatives and construction of expression plasmids. All constructs are based on the eukaryotic expression vector pCI (Promega), which carries the efficient eukaryotic cytomegalovirus promoter, a recombinant chimeric intron, the prokaryotic T7 promoter, the late simian virus 40 polyadenylation signal, and an ampicillin resistance marker.
The Y. pestis caf1 gene was cloned by PCR from the DNA of the virulent strain Kimberley53. For cloning of the full-length F1 gene, primers nF1 (ACTGCAGTCCACCCACCATGAAAATCAGTTCCGTTATCGCC) and cF1 (TCATCGGCGGCCGCCTATTATTGGTTAGATACGGTTACGG) were used. To generate an F1 derivative (deF1) lacking the putative bacterial signal peptide (16), primers nF2 (ACTGCAGTCCACCCACC ATGGCAGATTTAACTGCAAGCACC) and cF1 were used. The two resulting PCR products were digested by SalI and NotI and ligated to pCI plasmid linearized by the same restriction enzymes, yielding the pCI-F1 and pCI-deF1 expression vectors.o, 百拇医药
The Semliki Forest virus (SFV) E3-Y. pestis F1 fusion protein product (E3/F1) was generated as follows. The SFV E3 gene (198 bp, coding for 66 amino acids) was derived from a plasmid carrying SFV DNA (17, 19) as a PCR product using primers nE (CTCACAAAGCTAGCCACCATGTCCGCCC CGCTGATTACTG) and cE (CTCACGAATTCGGAGGCCTCCGGTGTCTTGTT CCGTTTCG). This fragment was then inserted into pCI between the NheI and StuI sites. The F1 sequence was inserted between the StuI and SalI sites to obtain pCI-E3/F1. All recombinant plasmids were verified by restriction enzyme analysis and sequencing.
In vitro translation of F1 derivatives. The coupled reticulocyte lysate in vitro transcription and translation system (TNT; Promega) was used as recommended by the manufacturer to generate 35S-labeled F1 derivatives. Translocation of the newly formed, labeled polypeptides into membranal fractions was examined by adding canine microsomes (Promega). Where indicated, translation products were treated with proteinase K (0.2 mg/ml; Sigma) for 15 min at 4°C in the presence or absence of 1% Triton X-100. The in vitro translated proteins were resolved by sodium dodecyl sulfate (SDS)-12.5% polyacrylamide gel electrophoresis (PAGE). Gels were fixed in 10% acetic acid-30% methanol for 12 h, soaked in Enhance solution (Du Pont) for 30 min, washed in water for 30 min, and dried on Whatman 3MM filter paper at 80°C. Gels were then exposed to Kodak X-Omat AR film at -70°C for the indicated times. 14C-labeled protein molecular weight (MW) markers (Rainbow High MW; Amersham) were included as protein size markers.
Transfection and visualization of expressed antigens. For visualization by immunofluorescence staining, recombinant plasmids were used to transiently transfect HEK293 cells (34) in individual wells of a Permonax chamber slide system (Nunc International) in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. At 24 h posttransfection, cells were fixed with acetone for 20 min at -20°C. The fixed cells were incubated with polyclonal rabbit anti-F1 antibodies (1:1,000 dilution) for 60 min, washed three times, and treated for 60 min with goat anti-rabbit antibodies conjugated to fluorescein isothiocyanate (Sigma). Immunolabeled cells were viewed with a Zeiss fluorescence microscope.i;, http://www.100md.com
For visualization by Western immunoblotting, transiently transfected HEK293 cells were detached, washed with phosphate-buffered saline (PBS), and resuspended in 0.025 M Tris, pH 8.0. Cells were disrupted by three rounds of freeze-thaw. Following centrifugation at 14,000 rpm in an Eppendorf microcentrifuge, cleared lysates were collected. Cell extracts were stored at -20°C until further use. Ten-microliter aliquots were resolved by SDS-12.5% PAGE and electroblotted onto nitrocellulose membranes. Blots were probed for 60 min with rabbit polyclonal anti-F1 antiserum (1/1,000 dilution in skimmed milk) followed by a 60-min incubation with horseradish peroxidase-conjugated goat anti-rabbit antibody (diluted 1/2,000; Sigma). Bound peroxidase was visualized by chemiluminescence (Pierce SuperSignal kit).
Metabolic labeling and immunoprecipitation. Metabolic labeling of HEK293 cells was performed essentially as described previously (21). Twenty-four hours posttransfection, cells were washed with fresh medium without methionine and incubated in the same medium for an additional 1 h. Medium containing [35S]methionine (0.8 to 1 mCi/ml) (Easytag; NEN) was then added for labeling for 1 h at 37°C. Cells were washed once with PBS and then chased at 37°C with medium containing nonlabeled methionine and 100 U of aprotinin (Sigma)/ml. At various chase periods, culture medium was collected and washed cells were lysed with PBS containing 0.5% Nonidet P-40, freshly prepared 0.2 M iodoacetamide, and 100 U of aprotinin/ml. Cleared lysates were generated by centrifugation at 14,000 rpm in an Eppendorf microcentrifuge for 10 min.twn, 百拇医药
Extracts of transfected cells were immunoprecipitated with rabbit polyclonal anti-F1 antibody and protein A-Sepharose. The labeled immunoprecipitated proteins were analyzed by SDS-PAGE followed by fluorography.
Preparation of plasmid DNA for immunization. The Endofree plasmid preparation kit (Qiagen Ltd., Hilden, Germany) was used for preparation of plasmid DNA stocks. Alternatively, large-scale production of plasmid DNA was performed by the alkali lysis method followed by CsCl gradient centrifugation. The concentration of plasmid DNA was determined by measurement of optical density at 260 nm, and its purity was evaluated by calculation of the A260/A280 ratio (1.8). DNA size and homogeneity were determined by 1% agarose gel electrophoresis.&, 百拇医药
For needle injections, purified DNA preparations were solubilized in pyrogen-free saline (Mini-Plasco; B. Braun) to a concentration of 3 mg/ml and were kept frozen in aliquots at -20°C until use. For gene gun vaccination, plasmid stocks were resuspended at 1 mg/ml in distilled pyrogen-free water and stored at -20°C until use.&, 百拇医药
DNA preparations were examined for the presence of endotoxins by Limulus amebocyte lysate testing using a kit from BioWhittaker (Walkersville, Md.). Endotoxin levels in all preparations were found to be lower then 0.05 endotoxin units/ml, which is the detection limit of the kit.
Bacterial strain used for challenge. All challenge experiments were performed with the Y. pestis Kimberley53 strain. Kimberley53 was obtained by passage of the Kimberley strain (originating from Instituto Oswaldo Cruz, Rio de Janeiro, Brazil [5]) in mice (subcutaneous [s.c.] inoculation and harvesting from spleen).lq&.iy, http://www.100md.com
The SCLD50 of this strain in mice is as low as 1 CFU. No difference in virulence was observed when ICR, BALB/c, and DBA/2 mice were tested. Bacteria for challenge were grown for 48 h at 28°C on brain heart infusion agar plates (Difco).lq&.iy, http://www.100md.com
Immunization and challenge with Y. pestis. The female outbred ICR mice and inbred BALB/c and DBA/2 mice (5 to 6 weeks old) used for vaccination were handled in accordance with the National Institute of Health's guide for the care and use of laboratory animals and the guidelines of the local commission for animal care.lq&.iy, http://www.100md.com
For DNA immunization by needle injections, a protocol of three or four immunizations at 2-week intervals was used. For each immunization, 200 µg of DNA was administered either into the tibialis anterior muscles of the two hind legs or into the tail base dermis.
For gene gun immunization, plasmid DNA was precipitated onto 1-µm-diameter gold particles at a ratio of 2 µg per milligram of gold and loaded onto Gold-Coat tubing as suggested by the manufacturer (Bio-Rad). Polyvinylpyrrolidone (MW, 360,000) was used as an adhesive at a concentration of 0.05 mg/ml. Agarose gel electrophoresis was used to determine the amount of DNA. Vaccination was carried out with three immunizations of 0.5 µg of DNA at 2-week intervals. Gene gun shots were directed into exposed abdominal dermis. At the indicated times, serum was collected in serum separator tubes (Microtainer tubes; Becton Dickinson). Antibody enzyme-linked immunosorbent assay (ELISA) titers were determined as described below. Immunized mice were challenged by s.c. injection of the indicated amounts of Y. pestis Kimberley53 strain suspension (0.1 ml). Animals were monitored daily for survival for a period of 3 weeks.0[v9u, http://www.100md.com
Passive immunization of mice was performed by transfer of serum derived from DNA-immunized mice or from mice immunized with F1 protein (see below). Antiserum aliquots of 1 ml per mouse were injected intraperitoneally (i.p.). Blood was withdrawn from the tail vein 10 h after transfer, and the levels of anti-F1 antibodies in the circulation were determined. Three hours later, the passively immunized mice were challenged with Y. pestis as described above.0[v9u, http://www.100md.com
Generation of purified F1 antigen and anti-F1 antisera. F1 antigen was extracted from Y. pestis EV76 (5) and purified by the method described by Baker and coworkers (4) to an estimated purity of(Haim Grosfeld Sara Cohen Tamar Bino Yehuda Flashner Raphael Ber Emanuelle Mamroud Chanoch Kronman Av)