SGK1 Kinase Upregulates GLUT1 Activity and Plasma Membrane Expression
http://www.100md.com
糖尿病学杂志 2006年第2期
1 Institute of Physiology I, University of Te筨ingen, Te筨ingen, Germany
2 Institute of Pharmacology, University of Berlin, Berlin, Germany
Key Words: 2-DOG, 2-deoxy-D-glucose GADPH, glyceraldehyde-3-phosphate dehydrogenase HEK, human embryonic kidney PI3 kinase, phosphatidylinositol 3-kinase PKB, protein kinase B
ABSTRACT
Phosphatidylinositol 3-kinase (PI3 kinase) inhibition disrupts the ability of insulin to stimulate GLUT1 and GLUT4 translocation into the cell membrane and thus glucose transport. The effect on GLUT4 but not on GLUT1 is mediated by activation of protein kinase B (PKB). The serum- and glucocorticoid-inducible kinase SGK1, a further kinase downstream of PI3 kinase, regulates several transporters by enhancing their plasma membrane abundance. GLUT1 contains a consensus site (95Ser) for phosphorylation by SGK1. Thus, the present study investigated whether GLUT1 is regulated by the kinase. Tracer-flux studies in Xenopus oocytes and HEK-293 cells demonstrated that GLUT1 transport is enhanced by constitutively active S422DSGK1. The effect requires the kinase catalytical activity since the inactive mutant K127NSGK1 failed to modulate GLUT1. GLUT1 stimulation by S422DSGK1 is not due to de novo protein synthesis but rather to an increase of the transporter’s abundance in the plasma membrane. Kinetic analysis revealed that SGK1 enhances maximal transport rate without altering GLUT1 substrate affinity. These observations suggest that SGK1 regulates GLUT1 and may contribute to or account for the PI3 kinaseeCdependent but PKB-independent stimulation of GLUT1 by insulin.
Insulin stimulates glucose transport in hormone-responsive tissues mainly by inducing the redistribution of the facilitated hexose carrier isoforms GLUT1 (SLC2A1) and GLUT4 (SLC2A4) from intracellular compartments to the plasma membrane (1eC3). The cascade of signaling events involved in glucose transporter trafficking to the cell surface in response to insulin is triggered by an increase in insulin receptor tyrosine kinase activity followed by tyrosine phosphorylation of insulin receptor substrate proteins and activation of phosphatidylinositol 3-kinase (PI3 kinase). Downstream elements of PI3 kinase include the phosphoinositide-dependent kinase PDK1, which in turn phosphorylates and thus activates the serine/threonine kinase Akt/protein kinase B (PKB) (4eC6).
The role of PI3 kinase in insulin-dependent and -independent stimulation of GLUT1 and GLUT4 translocation has been confirmed by several studies using pharmacological (Wortmannin and LY294002) blockade and genetic (PI3 kinase dominant-negative mutants) knockout of the kinase (7eC11). The effect of PI3 kinase on GLUT4 trafficking is mediated by PKB (12,13). PKB is, however, at least in some cells, not required for the PI3 kinaseeCdependent trafficking of GLUT1 (12). Thus, some other PI3 kinaseeCdependent protein kinases are presumably involved in the regulation of GLUT1.
A further downstream molecule in the PI3 kinase signaling cascade is the serum- and glucocorticoid-inducible kinase SGK1. SGK1 was originally cloned as a glucocorticoid-sensitive gene from rat mammary tumor cells (14) and later as a human cell volumeeCregulated gene (15). SGK1 shares 80% homology with its isoforms SGK2 and SGK3 (16) and 60% homology with PKB (17).
To become catalytically active, SGK1 requires phosphorylation through the PI3 kinase/PDK1 pathway (16eC18). Through this pathway, SGK1 and its isoforms are activated by growth factors such as IGF-1 and insulin (19eC21), by oxidative stress (18,20), and by exposure to hyperosmolarity (22). The enzymatic activity of SGK1 is disrupted upon inhibition of PI3 kinase (18).
SGKs have been shown to stimulate several transport proteins including the Na+,K+,2CleC cotransporter NKCC2 (23); the Na+/K+ ATPase (24,25); the dicarboxylate transporter NaDCT1 (26); the amino acid transporters SN1 (27), EAAT1 (28), EAAT3 (29), and EAAT4 (30); and the glucose transporter SGLT1 (31). Similar to protein kinase A, the kinases have been suggested to play a broad function in transport regulation (32). The GLUT1 amino acid sequence contains a potential SGK1 phosphorylation site at position 95Ser. Thus, the present work explored whether GLUT1 is regulated by SGK1.
In this study, we show that SGK1 modulates GLUT1 activity by enhancing GLUT1 abundance in the plasma membrane without altering total GLUT1 expression levels. The results suggest that the kinase acts as a signaling molecule downstream of PI3 kinase involved in GLUT1 trafficking to the cell surface.
RESEARCH DESIGN AND METHODS
Constructs and site-directed mutagenesis.
The constitutively active human S422DSGK1 (16) and inactive human K127NSGK1 (16) were kindly provided by Sir Philip Cohen (University of Dundee, Dundee, Scotland). The mutated human GLUT1 transporter S95AGLUT1 was generated by site-directed mutagenesis (QuikChange site-directed mutagenesis kit; Stratagene, Heidelberg, Germany) according to the manufacturer’s instructions. The following primers were used: S95AGLUT1 s: 5' CTTTGGCCGGCGGAATGCAATGCTGATGATGAAC 3' and S95AGLUT1as: 5' GTTCATCATCAGCATTGCATTCCGCCGGCCAAAG 3'. The S95AGLUT1 mutant was sequenced to verify the presence of the desired mutation.
Expression in Xenopus laevis oocytes.
cRNA encoding human GLUT1 (33), S95AGLUT1, human constitutively active S422DSGK1, inactive K127NSGK1 (20), and human Nedd4-2 were synthesized in vitro as described previously (34). Dissection of Xenopus laevis ovaries and collection and handling of the oocytes have been described in detail elsewhere (34). Oocytes were injected with 1 ng GLUT1 or S95AGLUT1 and/or 7.5 ng S422DSGK1, K127NSGK1, or Nedd4-2. H2O-injected oocytes served as control.
Cell transfections.
Human embryonic kidney (HEK)-293 cells were incubated in Dulbecco’s modified Eagle’s medium containing 4.5 g/l glucose, 10% FCS, and 1% penicillin-streptomycin (Invitrogen, Karlsruhe, Germany). Cells were seeded on six-well plates at 0.2 x 106 cells/well. After 24 h, cells were transfected with 2 e蘥 pIRES2EGFP-S422DSGK1 or pIRES2EGFP-K127NSGK1 by using Lipofectamine (Invitrogen) according to the manufacturer's instructions. As a control, cells were transfected with 2 e蘥 pIRES2EGFP empty vector (Clontech, Heidelberg, Germany).
Isolation of mice adipocytes.
Adipocytes were isolated from 129/SvJ mice epididymal fat pads by collagenase digestion as previously described (35). The fat pads were minced and digested with 2 mg/ml type II collagenase for 1 h at 37°C in Krebs Ringer bicarbonate HEPES buffer (120 mmol/l NaCl, 4 mmol/l KH2PO4, 1 mmol/l MgSO4, 1 mmol/l CaCl2, 10 mmol/l NaHCO3, 200 nmol/l adenosine, and 30 mmol/l HEPES, pH 7.4) containing 1% fraction V BSA. The resulting cell suspension was filtered through a nylon mesh (250 e蘭) and washed three times with Krebs Ringer bicarbonate HEPES buffer containg 3% BSA. Then adipocytes were resuspended in Krebs Ringer bicarbonate HEPES buffer with 3% BSA. An aliquot of the final cellular suspension was taken to measure lipocrit and cell number.
Transport studies.
Tritium-labeled 2-deoxy-D-glucose (2-DOG) was used as the glucose analog for uptake determination. In Xenopus oocytes, the transport assay was performed 4 days after cRNA injection and contained 10eC15 single oocytes in 0.25 ml ND96 (96 mmol/l NaCl, 2 mmol/l KCl, 1.8 mmol/l CaCl2, 1 mmol/l MgCl2, and 5 mmol/l HEPES, pH 7.4) containing 1 e藽i 3H 2-DOG and 50 e蘭ol/l (or the indicated amount in the kinetic analysis) of unlabeled 2-DOG. After incubation for 30 min at room temperature with 2-DOG (linear range of uptake), uptake was terminated by washing the oocytes four times with 3 ml ice-cold PBS containing 100 mmol/l unlabeled 2-DOG. Oocytes were individually transferred into scintillation vials and dissolved by adding 200 e蘬 of 10% SDS before the radioactivity was determined. In HEK-293 cells, 2-DOG uptake was measured 2 days after transfection by incubating the cells at 37°C for 5 min (linear range of uptake) in glucose-free Krebs Ringer HEPES buffer containing 3H 2-DOG 0.1 e藽i/well and 0.3 mmol/l cold 2-DOG with or without 0.1 mmol/l phloretin. Uptake was terminated by rapid aspiration of uptake solution and washing four times with ice-cold PBS containing 50 mmol/l unlabeled 2-DOG. Thereafter, cells were lysed with 10 mmol/l NaOH/0.1% Triton X-100, and radioactivity incorporated into the cells was measured with a liquid scintillation counter. Protein concentrations were determined by the Bradford method. For kinetic analysis, 2-DOG uptake was measured by incubating the cells with 3H 2-DOG 0.1 e藽i/well and various concentrations of unlabeled 2-DOG at 37°C for 5 min. In isolated adipocytes, 2-DOG uptake was measured by incubating the cells with 0.1 e藽i 3H 2-DOG and 0.1 mmol/l cold 2-DOG with or without 0.1 mmol/l phloretin. Uptake was terminated after 5 min by centrifugation of cells through dinonylphthalate. The separated cells were removed from the top of the oil layer, and cell-associated radioactivity was quantified.
Detection of cell surface expression by chemiluminescence.
Defolliculated oocytes were first injected with constitutively active SGK1 (15 ng/oocyte) and 1 day later with GLUT1 (1 ng/oocyte). Oocytes were incubated with 2 e蘥/ml primary goat polyclonal anti-GLUT1 antibody (Santa Cruz Biotechnology, Heidelberg, Germany), which recognizes an extracellular GLUT1 sequence, and 4 e蘥/ml secondary, peroxidase-conjugated donkey anti-goat IgG antibody (Santa Cruz Biotechnology, Heidelberg, Germany) for the analysis of GLUT1 protein abundance in the cell membrane. Individual oocytes were placed in 20 e蘬 of SuperSignal ELISA Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL), and chemiluminescence was quantified by luminometry by integrating the signal over a period of 1 s.
Western blotting.
To determine whole-cell GLUT1 and SGK1 expression in oocytes, transfected HEK-293 cells, and adipocytes, cells were homogenized in lysis buffer, and 30 e蘥 protein were separated on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane. After blocking with 5% nonfat dry milk in PBS/0.15% Tween 20 for 1 h at room temperature, blots were incubated overnight at 4°C with a goat anti-GLUT1 antibody (diluted 1:100 in PBS/0.15% Tween 20/5% nonfat dry milk; Santa Cruz Biotechnology), a rabbit anti-SGK1 antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk; Upstate, Dundee, U.K.), or a rabbit antieCglyceraldehyde-3-phosphate dehydrogenase (GAPDH) horseradish peroxidaseeCconjugated antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk). GAPDH was used to demonstrate equal protein loading. Secondary peroxidase-conjugated donkey anti-goat IgG antibody (diluted 1:2000 in PBS/0.15% Tween 20/5% nonfat dry milk; Santa Cruz Biotechnology) or sheep anti-rabbit IgG antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk; Amersham, Freiburg, Germany) was used for chemiluminescent detection of GLUT1 or SGK1 with an enhanced chemiluminescence kit (Amersham), respectively. Band intensities were quantified using Quantity One Analysis software (Biorad, Munich, Germany).
Calculations.
Data are provided as means ± SE, and n represents the number of oocytes investigated. All experiments were repeated with at least three batches of oocytes. In all repetitions, qualitatively similar data were obtained. All data were tested for significance using ANOVA, and only results with P < 0.05, P < 0.01, and P < 0.005 were considered as statistically significant.
RESULTS
To investigate the role of SGK1 in the modulation of GLUT1 activity, GLUT1 was expressed in Xenopus laevis oocytes and glucose transport was measured in the presence and absence of the protein kinase. Tracer-flux studies revealed an increase in GLUT1 transport rate (177.1 ± 21.3% of control, n = 10, Fig. 1) upon coexpression of S422DSGK1. Glucose uptake into water-injected oocytes or oocytes expressing constitutively active S422DSGK1 alone was <6.3 ± 2.3% of control (n = 26eC37). GLUT1 upregulation by SGK1 was dependent on the catalytic activity of the kinase, as the inactive mutant K127NSGK1 did not significantly modify the transporter (70.6 ± 17.2% of control, n = 8).
To test whether SGK1 modulates GLUT1 uptake by phosphorylating GLUT1, the putative phosphorylation site at 95Ser in GLUT1 was mutated into alanine (S95AGLUT1). Disruption of the putative SGK phosphorylation site did not prevent GLUT1 stimulation by S422DSGK1 (239.8 ± 32.7% of control, n = 46), suggesting that the kinase is effective through phosphorylation of an intermediate protein (Fig. 2).
Some of the transporters modulated by SGKs (31,36,37) are indirectly regulated through phosphorylation and thus inhibition of the ubiquitin ligase Nedd4-2, which otherwise tags its target protein for degradation. To assess whether GLUT1 is modulated by Nedd4-2, the transporter was expressed in Xenopus oocytes and transport activity was measured in the presence and absence of the ubiquitin ligase. Nedd4-2 coexpression did not significantly affect GLUT1 activity (87.2 ± 7.8% of control, n = 15, Fig. 3). Thus, the ubiquitin ligase is apparently not involved in the regulation of GLUT1.
A detailed kinetic analysis of GLUT1 revealed that S422DSGK1 enhances GLUT1 by modifying the maximal transport rate, Vmax, without affecting substrate affinity (Fig. 4 and Table 1).
GLUT1 plasma membrane abundance was studied with or without SGK1 coexpression. Chemiluminescence experiments revealed that GLUT1 surface expression was higher in oocytes coexpressing S422DSGK1 (134.9 ± 12.8%, n = 50) than in oocytes expressing GLUT1 alone (n = 53, Fig. 5A). Thus, GLUT1 modulation by S422DSGK1 is due to increased transporter abundance in the plasma membrane. Enhanced GLUT1 plasma membrane expression is not due to induced GLUT1 de novo protein synthesis as indicated by western blotting of whole-cell lysates (Fig. 5B).
GLUT1 modulation by SGK1 was also observed in mammalian cells (HEK-293). HEK-293 cells were transfected with pIRES2EGFP-S422DSGK1, pIRES2EGFP-K127NSGK1, or with empty vector (as a control), and 2 days later 2-DOG uptake was measured in the presence and absence of GLUT1 inhibitor phloretin (0.1 mmol/l). Tracer-flux studies revealed an increase in GLUT1 transport rate (from 2.3 ± 0.6 [n = 3] to 5.1 ± 0.6 nmol · mineC1 · mg proteineC1 [n = 3], Fig. 6A) upon coexpression of S422DSGK1. As observed in Xenopus oocytes, GLUT1 upregulation by SGK1 was dependent on the catalytic activity of the kinase, as the effect was lacking upon expression of the catalytical inactive mutant K127NSGK1 (from 2.3 ± 0.6 [n = 3] to 1.8 ± 0.2 nmol · mineC1 · mg proteineC1 [n = 3]). Western blotting of whole-cell lysates indicated that the kinase fails to induce GLUT1 protein synthesis (Fig. 6B).
Kinetic analysis of 2-DOG uptake in transfected HEK-293 cells revealed that S422DSGK1 enhances GLUT1 by modifying the maximal transport rate, Vmax (from 17.7 ± 2.3 [n = 3] to 44.9 ± 4.4 nmol · mineC1 · mg proteineC1 [n = 3]), thereby corroborating the results obtained in the Xenopus oocyte expression system (Fig. 7 and Table 2).
Tracer-flux studies in adipocytes isolated from sgk1+/+ and sgk1eC/eC mice demonstrated the role of SGK1 in glucose transport regulation. As depicted in Fig. 8A, 2-DOG uptake was lower (55.67 ± 16.46%) in adipocytes isolated from sgk1eC/eC mice compared with sgk1+/+ mice despite similar total GLUT1 expression levels (Fig. 8B).
DISCUSSION
Similar to what has been shown for the Na+-coupled glucose transporter 1 (SGLT1) (31), SGK1 stimulates the facilitated glucose transporter GLUT1 by enhancing transporter abundance in the plasma membrane. The effect requires the catalytical activity of the kinase. SGK1 shuttles between cytoplasm and nucleus in a stimulus-dependent manner (38). The serum-induced nuclear import of SGK1 suggests that SGK1 acts at a transcriptional level. In fact, SGK1 has been shown to modulate the forkhead transcription factor FKHRL1 (39). Thus, SGK1 might regulate glucose transport in part by increasing GLUT1 transcript levels. However, the stimulation of glucose transport in Xenopus oocytes point to posttranscriptional regulation of GLUT1, as GLUT1 mRNA has been injected thus circumventing transcription. In addition, Western blotting of whole-cell lysates exclude GLUT1 regulation at a translational level.
SGK1 is not effective through phosphorylation of GLUT1, since the Ser-to-Ala mutation in the SGK consensus site failed to prevent SGK-mediated stimulation of glucose transport. Several channels and transporters are indirectly regulated through phosphorylation of the ubiquitin ligase Nedd4-2, which decreases the affinity of the enzyme to its target molecules and thus delays the clearance of the transport proteins from the cell membrane (31,36,37). As coexpression of Nedd4-2 did not alter GLUT1 activity, we exclude this mechanism of SGK action.
Phosphorylation-dependent events have previously been shown to modulate GLUT1 activity. Protein kinase C isozymes PKCII, -, and - stimulate GLUT1 by recruiting GLUT1 transporter to the cell membrane (40), and the AMP-activated protein kinase stimulates GLUT1 without affecting the total amount of GLUT1 protein at the cell surface (41). The AMP-activated protein kinase downstream target(s) have not yet been identified.
According to our results, SGK1 could play a similar role in the regulation of GLUT1 as PKB plays in the regulation of GLUT4. In some studies on adipocytes, constitutively active PKB has been able to upregulate GLUT4 but not GLUT1 (12). Insulin, however, upregulated both GLUT1 and GLUT4, and both effects were abrogated by inhibition of PI3 kinase (12). On the other hand, dominant inhibitory PKB has been shown to inhibit the insulin-mediated increase in GLUT1 protein abundance (42), and PKB has been reported to stimulate GLUT1 translocation to the cell membrane (43), suggesting a role of PKB in the regulation of GLUT1. Moreover, insulin may (12) or may not (44) stimulate GLUT1. Thus, the regulation of GLUT1 may depend on the experimental condition and may be supported by PKB and/or SGK1. It should be kept in mind that the transcription of SGK1 is highly variable and subject to a number of regulators (5), and thus SGK1-dependent effects may be similarly variable. GLUT1 modulation by SGK1 reported in this study is not restricted to the Xenopus oocyte expression system, as similar results were obtained in cultured mammalian cells. The observed reduced glucose transport in adipocytes isolated from sgk1eC/eC mice points to a physiological role of the kinase in glucose transport regulation.
SGK-dependent stimulation of GLUT1 transporters may be of relevance in the cellular uptake of glucose into several tissues including the brain and defective SGK dependent regulation of GLUT1 may contribute to the GLUT1 deficiency syndrome characterized by a defect in GLUT1 translocation to the plasma membrane (45). Notably, SGK1 expression is upregulated by cerebral ischemia (46) and may help to enhance cellular glucose uptake into the ischemic tissue. Moreover, the enhanced cerebral SGK1 expression in enriched environment (47) may serve to adjust glucose uptake to the enhanced demand following stimulation of neuronal activity. As a matter of fact, SGK1-dependent regulation of glucose transport is reflected by delayed glucose uptake into several tissues in the SGK1 knockout mouse following an intraperitoneal glucose tolerance test (K.M. Boini, A.M. Hennige, D.Y. Huang, B. Friedrich, M.P., C.B., F. Grahammer, F. Artunc, H. Osswald, P. Wulff, D. Kuhl, V. Vallon, H.U. Hring, F.L., unpublished observations).
In conclusion, the facilitated glucose transporter GLUT1 is modulated by the serum- and glucocorticoid-inducible kinase SGK1. The kinase stimulates GLUT1 by enhancing the transporter plasma membrane abundance and is effective through phosphorylation of a hitherto unknown intermediate protein. The SGK1-dependent regulation of GLUT1 may participate in the adjustment of cellular glucose uptake to the demand.
ACKNOWLEDGMENTS
This study was supported by the Deutsche Forschungsgemeinschaft (La 315/4-6), a Marie Curie Research Fellowship (QLGA-CT-2001-52014) to M.P., and a research grant (Nr. 1190D) from Damascus University to A.A.
The authors acknowledge the technical assistance of B. Noll and the meticulous preparation of the manuscript by T. Loch and L. Subasic.
REFERENCES
Cushman SW, Wardzala LJ: Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell: apparent translocation of intracellular transport systems to the plasma membrane. J Biol Chem 255:4758eC4762, 1980
James DE, Pilch PF: Fractionation of endocytic vesicles and glucose-transporter-containing vesicles in rat adipocytes. Biochem J 256:725eC732, 1988
Suzuki K, Kono T: Evidence that insulin causes translocation of glucose transport activity to the plasma membrane from an intracellular storage site. Proc Natl Acad Sci U S A 77:2542eC2545, 1980
Khan AH, Pessin JE: Insulin regulation of glucose uptake: a complex interplay of intracellular signalling pathways. Diabetologia 45:1475eC1483, 2002
Lang F, Cohen P: Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms (Review). Sci STKE 2001:RE17, 2001
Virkamaki A, Ueki K, Kahn CR: Protein-protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J Clin Invest 103:931eC943, 1999
Cheatham B, Vlahos CJ, Cheatham L, Wang L, Blenis J, Kahn CR: Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14:4902eC4911, 1994
Haruta T, Morris AJ, Rose DW, Nelson JG, Mueckler M, Olefsky JM: Insulin-stimulated GLUT4 translocation is mediated by a divergent intracellular signaling pathway. J Biol Chem 270:27991eC27994, 1995
Kotani K, Carozzi AJ, Sakaue H, Hara K, Robinson LJ, Clark SF, Yonezawa K, James DE, Kasuga M: Requirement for phosphoinositide 3-kinase in insulin-stimulated GLUT4 translocation in 3T3eCL1 adipocytes. Biochem Biophys Res Commun 209:343eC348, 1995
Okada T, Kawano Y, Sakakibara T, Hazeki O, Ui M: Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes: studies with a selective inhibitor wortmannin. J Biol Chem 269:3568eC3573, 1994
Perrini S, Natalicchio A, Laviola L, Belsanti G, Montrone C, Cignarelli A, Minielli V, Grano M, De Pergola G, Giorgino R, Giorgino F: Dehydroepiandrosterone stimulates glucose uptake in human and murine adipocytes by inducing GLUT1 and GLUT4 translocation to the plasma membrane. Diabetes 53:41eC52, 2004
Foran PG, Fletcher LM, Oatey PB, Mohammed N, Dolly JO, Tavare JM: Protein kinase B stimulates the translocation of GLUT4 but not GLUT1 or transferrin receptors in 3T3eCL1 adipocytes by a pathway involving SNAP-23, synaptobrevin-2, and/or cellubrevin. J Biol Chem 274:28087eC28095, 1999
Zhou QL, Park JG, Jiang ZY, Holik JJ, Mitra P, Semiz S, Guilherme A, Powelka AM, Tang X, Virbasius J, Czech MP: Analysis of insulin signalling by RNAi-based gene silencing. Biochem Soc Trans 32:817eC821, 2004
Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL: Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13:2031eC2040, 1993
Waldegger S, Barth P, Raber G, Lang F: Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A 94:4440eC4445, 1997
Kobayashi T, Deak M, Morrice N, Cohen P: Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344:189eC197, 1999
Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA: Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15:6541eC6551, 1996
Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, Hemmings BA: Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18:3024eC3033, 1999
Buse P, Tran SH, Luther E, Phu PT, Aponte GW, Firestone GL: Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, Sgk, in mammary tumor cells: a novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274:7253eC7263, 1999
Kobayashi T, Cohen P: Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339:319eC328, 1999
Perrotti N, He RA, Phillips SA, Haft CR, Taylor SI: Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem 276:9406eC9412, 2001
Bell LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, Firestone GL: Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem 275:25262eC25272, 2000
Lang F, Ritter M, Gamper N, Huber S, Fillon S, Tanneur V, Lepple-Wienhues A, Szabo I, Gulbins E: Cell volume in the regulation of cell proliferation and apoptotic cell death. Cell Physiol Biochem 10:417eC428, 2000
Setiawan I, Henke G, Feng Y, Bohmer C, Vasilets LA, Schwarz W, Lang F: Stimulation of Xenopus oocyte Na(+),K(+)ATPase by the serum and glucocorticoid-dependent kinase sgk1. Pflugers Arch 444:426eC431, 2002
Zecevic M, Heitzmann D, Camargo SM, Verrey F: SGK1 increases Na,K-ATP cell-surface expression and function in Xenopus laevis oocytes. Pflugers Arch 448:29eC35, 2004
Boehmer C, Embark HM, Bauer A, Palmada M, Yun CH, Weinman EJ, Endou H, Cohen P, Lahme S, Bichler KH, Lang F: Stimulation of renal Na+ dicarboxylate cotransporter 1 by Na+/H+ exchanger regulating factor 2, serum and glucocorticoid inducible kinase isoforms, and protein kinase B. Biochem Biophys Res Commun 313:998eC1003, 2004
Boehmer C, Okur F, Setiawan I, Broer S, Lang F: Properties and regulation of glutamine transporter SN1 by protein kinases SGK and PKB. Biochem Biophys Res Commun 306:156eC162, 2003
Boehmer C, Henke G, Schniepp R, Palmada M, Rothstein JD, Broer S, Lang F: Regulation of the glutamate transporter EAAT1 by the ubiquitin ligase Nedd4-2 and the serum and glucocorticoid-inducible kinase isoforms SGK1/3 and protein kinase B. J Neurochem 86:1181eC1188, 2003
Schniepp R, Kohler K, Ladewig T, Guenther E, Henke G, Palmada M, Boehmer C, Rothstein JD, Broer S, Lang F: Retinal colocalization and in vitro interaction of the glutamate transporter EAAT3 and the serum- and glucocorticoid-inducible kinase SGK1. Invest Ophthalmol Vis Sci 45:1442eC1449, 2004 [correction]
Bohmer C, Philippin M, Rajamanickam J, Mack A, Broer S, Palmada M, Lang F: Stimulation of the EAAT4 glutamate transporter by SGK protein kinase isoforms and PKB. Biochem Biophys Res Commun 324:1242eC1248, 2004
Dieter M, Palmada M, Rajamanickam J, Aydin A, Busjahn A, Boehmer C, Luft FC, Lang F: Regulation of glucose transporter SGLT1 by ubiquitin ligase Nedd4-2 and kinases SGK1, SGK3, and PKB. Obes Res 12:862eC870, 2004
Lang F, Henke G, Embark HM, Waldegger S, Palmada M, Bohmer C, Vallon V: Regulation of channels by the serum and glucocorticoid-inducible kinase: implications for transport, excitability and cell proliferation. Cell Physiol Biochem 13:41eC50, 2003
Keller K, Mueckler M: Different mammalian facilitative glucose transporters expressed in Xenopus oocytes. Biomed Biochim Acta 49:1201eC1203, 1990
Wagner CA, Friedrich B, Setiawan I, Lang F, Broer S: The use of Xenopus laevis oocytes for the functional characterization of heterologously expressed membrane proteins. Cell Physiol Biochem 10:1eC12, 2000
Ruan H, Zarnowski MJ, Cushman SW, Lodish HF: Standard isolation of primary adipose cells from mouse epididymal fat pads induces inflammatory mediators and down-regulates adipocyte genes. J Biol Chem 278:47585eC47593, 2003
Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, Staub O: Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J 20:7052eC7059, 2001
Palmada M, Dieter M, Speil A, Bohmer C, Mack AF, Wagner HJ, Klingel K, Kandolf R, Murer H, Biber J, Closs EI, Lang F: Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1. Am J Physiol Gastrointest Liver Physiol 287:G143eCG150, 2004
Firestone GL, Giampaolo JR, O’Keeffe BA: Stimulus-dependent regulation of the serum and glucocorticoid inducible protein kinase (Sgk) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem 13:1eC12, 2003
Brunet A, Park J, Tran H, Hu LS, Hemmings BA, Greenberg ME: Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21:952eC965, 2001
Cooper DR, Watson JE, Patel N, Illingworth P, Acevedo-Duncan M, Goodnight J, Chalfant CE, Mischak H: Ectopic expression of protein kinase CbetaII, -delta, and -epsilon, but not -betaI or -zeta, provide for insulin stimulation of glucose uptake in NIH-3T3 cells. Arch Biochem Biophys 372:69eC79, 1999
Barnes K, Ingram JC, Porras OH, Barros LF, Hudson ER, Fryer LG, Foufelle F, Carling D, Hardie DG, Baldwin SA: Activation of GLUT1 by metabolic and osmotic stress: potential involvement of AMP-activated protein kinase (AMPK). J Cell Sci 115:2433eC2442, 2002
Taha C, Liu Z, Jin J, Al Hasani H, Sonenberg N, Klip A: Opposite translational control of GLUT1 and GLUT4 glucose transporter mRNAs in response to insulin: role of mammalian target of rapamycin, protein kinase b, and phosphatidylinositol 3-kinase in GLUT1 mRNA translation. J Biol Chem 274:33085eC33091, 1999
Rathmell JC, Fox CJ, Plas DR, Hammerman PS, Cinalli RM, Thompson CB: Akt-directed glucose metabolism can prevent Bax conformation change and promote growth factor-independent survival. Mol Cell Biol 23:7315eC7328, 2003
Houdali B, Nguyen V, Ammon HP, Haap M, Schechinger W, Machicao F, Rett K, Haring HU, Schleicher ED: Prolonged glucose infusion into conscious rats inhibits early steps in insulin signalling and induces translocation of GLUT4 and protein kinase C in skeletal muscle. Diabetologia 45:356eC368, 2002
Klepper J, Voit T: Facilitated glucose transporter protein type 1 (GLUT1) deficiency syndrome: impaired glucose transport into brain: a review. Eur J Pediatr 161:295eC304, 2002
Nishida Y, Nagata T, Takahashi Y, Sugahara-Kobayashi M, Murata A, Asai S: Alteration of serum/glucocorticoid regulated kinase-1 (sgk-1) gene expression in rat hippocampus after transient global ischemia. Brain Res Mol Brain Res 123:121eC125, 2004
Lee EH, Hsu WL, Ma YL, Lee PJ, Chao CC: Enrichment enhances the expression of sgk, a glucocorticoid-induced gene, and facilitates spatial learning through glutamate AMPA receptor mediation. Eur J Neurosci 18:2842eC2852, 2003(Monica Palmada, Christoph)
2 Institute of Pharmacology, University of Berlin, Berlin, Germany
Key Words: 2-DOG, 2-deoxy-D-glucose GADPH, glyceraldehyde-3-phosphate dehydrogenase HEK, human embryonic kidney PI3 kinase, phosphatidylinositol 3-kinase PKB, protein kinase B
ABSTRACT
Phosphatidylinositol 3-kinase (PI3 kinase) inhibition disrupts the ability of insulin to stimulate GLUT1 and GLUT4 translocation into the cell membrane and thus glucose transport. The effect on GLUT4 but not on GLUT1 is mediated by activation of protein kinase B (PKB). The serum- and glucocorticoid-inducible kinase SGK1, a further kinase downstream of PI3 kinase, regulates several transporters by enhancing their plasma membrane abundance. GLUT1 contains a consensus site (95Ser) for phosphorylation by SGK1. Thus, the present study investigated whether GLUT1 is regulated by the kinase. Tracer-flux studies in Xenopus oocytes and HEK-293 cells demonstrated that GLUT1 transport is enhanced by constitutively active S422DSGK1. The effect requires the kinase catalytical activity since the inactive mutant K127NSGK1 failed to modulate GLUT1. GLUT1 stimulation by S422DSGK1 is not due to de novo protein synthesis but rather to an increase of the transporter’s abundance in the plasma membrane. Kinetic analysis revealed that SGK1 enhances maximal transport rate without altering GLUT1 substrate affinity. These observations suggest that SGK1 regulates GLUT1 and may contribute to or account for the PI3 kinaseeCdependent but PKB-independent stimulation of GLUT1 by insulin.
Insulin stimulates glucose transport in hormone-responsive tissues mainly by inducing the redistribution of the facilitated hexose carrier isoforms GLUT1 (SLC2A1) and GLUT4 (SLC2A4) from intracellular compartments to the plasma membrane (1eC3). The cascade of signaling events involved in glucose transporter trafficking to the cell surface in response to insulin is triggered by an increase in insulin receptor tyrosine kinase activity followed by tyrosine phosphorylation of insulin receptor substrate proteins and activation of phosphatidylinositol 3-kinase (PI3 kinase). Downstream elements of PI3 kinase include the phosphoinositide-dependent kinase PDK1, which in turn phosphorylates and thus activates the serine/threonine kinase Akt/protein kinase B (PKB) (4eC6).
The role of PI3 kinase in insulin-dependent and -independent stimulation of GLUT1 and GLUT4 translocation has been confirmed by several studies using pharmacological (Wortmannin and LY294002) blockade and genetic (PI3 kinase dominant-negative mutants) knockout of the kinase (7eC11). The effect of PI3 kinase on GLUT4 trafficking is mediated by PKB (12,13). PKB is, however, at least in some cells, not required for the PI3 kinaseeCdependent trafficking of GLUT1 (12). Thus, some other PI3 kinaseeCdependent protein kinases are presumably involved in the regulation of GLUT1.
A further downstream molecule in the PI3 kinase signaling cascade is the serum- and glucocorticoid-inducible kinase SGK1. SGK1 was originally cloned as a glucocorticoid-sensitive gene from rat mammary tumor cells (14) and later as a human cell volumeeCregulated gene (15). SGK1 shares 80% homology with its isoforms SGK2 and SGK3 (16) and 60% homology with PKB (17).
To become catalytically active, SGK1 requires phosphorylation through the PI3 kinase/PDK1 pathway (16eC18). Through this pathway, SGK1 and its isoforms are activated by growth factors such as IGF-1 and insulin (19eC21), by oxidative stress (18,20), and by exposure to hyperosmolarity (22). The enzymatic activity of SGK1 is disrupted upon inhibition of PI3 kinase (18).
SGKs have been shown to stimulate several transport proteins including the Na+,K+,2CleC cotransporter NKCC2 (23); the Na+/K+ ATPase (24,25); the dicarboxylate transporter NaDCT1 (26); the amino acid transporters SN1 (27), EAAT1 (28), EAAT3 (29), and EAAT4 (30); and the glucose transporter SGLT1 (31). Similar to protein kinase A, the kinases have been suggested to play a broad function in transport regulation (32). The GLUT1 amino acid sequence contains a potential SGK1 phosphorylation site at position 95Ser. Thus, the present work explored whether GLUT1 is regulated by SGK1.
In this study, we show that SGK1 modulates GLUT1 activity by enhancing GLUT1 abundance in the plasma membrane without altering total GLUT1 expression levels. The results suggest that the kinase acts as a signaling molecule downstream of PI3 kinase involved in GLUT1 trafficking to the cell surface.
RESEARCH DESIGN AND METHODS
Constructs and site-directed mutagenesis.
The constitutively active human S422DSGK1 (16) and inactive human K127NSGK1 (16) were kindly provided by Sir Philip Cohen (University of Dundee, Dundee, Scotland). The mutated human GLUT1 transporter S95AGLUT1 was generated by site-directed mutagenesis (QuikChange site-directed mutagenesis kit; Stratagene, Heidelberg, Germany) according to the manufacturer’s instructions. The following primers were used: S95AGLUT1 s: 5' CTTTGGCCGGCGGAATGCAATGCTGATGATGAAC 3' and S95AGLUT1as: 5' GTTCATCATCAGCATTGCATTCCGCCGGCCAAAG 3'. The S95AGLUT1 mutant was sequenced to verify the presence of the desired mutation.
Expression in Xenopus laevis oocytes.
cRNA encoding human GLUT1 (33), S95AGLUT1, human constitutively active S422DSGK1, inactive K127NSGK1 (20), and human Nedd4-2 were synthesized in vitro as described previously (34). Dissection of Xenopus laevis ovaries and collection and handling of the oocytes have been described in detail elsewhere (34). Oocytes were injected with 1 ng GLUT1 or S95AGLUT1 and/or 7.5 ng S422DSGK1, K127NSGK1, or Nedd4-2. H2O-injected oocytes served as control.
Cell transfections.
Human embryonic kidney (HEK)-293 cells were incubated in Dulbecco’s modified Eagle’s medium containing 4.5 g/l glucose, 10% FCS, and 1% penicillin-streptomycin (Invitrogen, Karlsruhe, Germany). Cells were seeded on six-well plates at 0.2 x 106 cells/well. After 24 h, cells were transfected with 2 e蘥 pIRES2EGFP-S422DSGK1 or pIRES2EGFP-K127NSGK1 by using Lipofectamine (Invitrogen) according to the manufacturer's instructions. As a control, cells were transfected with 2 e蘥 pIRES2EGFP empty vector (Clontech, Heidelberg, Germany).
Isolation of mice adipocytes.
Adipocytes were isolated from 129/SvJ mice epididymal fat pads by collagenase digestion as previously described (35). The fat pads were minced and digested with 2 mg/ml type II collagenase for 1 h at 37°C in Krebs Ringer bicarbonate HEPES buffer (120 mmol/l NaCl, 4 mmol/l KH2PO4, 1 mmol/l MgSO4, 1 mmol/l CaCl2, 10 mmol/l NaHCO3, 200 nmol/l adenosine, and 30 mmol/l HEPES, pH 7.4) containing 1% fraction V BSA. The resulting cell suspension was filtered through a nylon mesh (250 e蘭) and washed three times with Krebs Ringer bicarbonate HEPES buffer containg 3% BSA. Then adipocytes were resuspended in Krebs Ringer bicarbonate HEPES buffer with 3% BSA. An aliquot of the final cellular suspension was taken to measure lipocrit and cell number.
Transport studies.
Tritium-labeled 2-deoxy-D-glucose (2-DOG) was used as the glucose analog for uptake determination. In Xenopus oocytes, the transport assay was performed 4 days after cRNA injection and contained 10eC15 single oocytes in 0.25 ml ND96 (96 mmol/l NaCl, 2 mmol/l KCl, 1.8 mmol/l CaCl2, 1 mmol/l MgCl2, and 5 mmol/l HEPES, pH 7.4) containing 1 e藽i 3H 2-DOG and 50 e蘭ol/l (or the indicated amount in the kinetic analysis) of unlabeled 2-DOG. After incubation for 30 min at room temperature with 2-DOG (linear range of uptake), uptake was terminated by washing the oocytes four times with 3 ml ice-cold PBS containing 100 mmol/l unlabeled 2-DOG. Oocytes were individually transferred into scintillation vials and dissolved by adding 200 e蘬 of 10% SDS before the radioactivity was determined. In HEK-293 cells, 2-DOG uptake was measured 2 days after transfection by incubating the cells at 37°C for 5 min (linear range of uptake) in glucose-free Krebs Ringer HEPES buffer containing 3H 2-DOG 0.1 e藽i/well and 0.3 mmol/l cold 2-DOG with or without 0.1 mmol/l phloretin. Uptake was terminated by rapid aspiration of uptake solution and washing four times with ice-cold PBS containing 50 mmol/l unlabeled 2-DOG. Thereafter, cells were lysed with 10 mmol/l NaOH/0.1% Triton X-100, and radioactivity incorporated into the cells was measured with a liquid scintillation counter. Protein concentrations were determined by the Bradford method. For kinetic analysis, 2-DOG uptake was measured by incubating the cells with 3H 2-DOG 0.1 e藽i/well and various concentrations of unlabeled 2-DOG at 37°C for 5 min. In isolated adipocytes, 2-DOG uptake was measured by incubating the cells with 0.1 e藽i 3H 2-DOG and 0.1 mmol/l cold 2-DOG with or without 0.1 mmol/l phloretin. Uptake was terminated after 5 min by centrifugation of cells through dinonylphthalate. The separated cells were removed from the top of the oil layer, and cell-associated radioactivity was quantified.
Detection of cell surface expression by chemiluminescence.
Defolliculated oocytes were first injected with constitutively active SGK1 (15 ng/oocyte) and 1 day later with GLUT1 (1 ng/oocyte). Oocytes were incubated with 2 e蘥/ml primary goat polyclonal anti-GLUT1 antibody (Santa Cruz Biotechnology, Heidelberg, Germany), which recognizes an extracellular GLUT1 sequence, and 4 e蘥/ml secondary, peroxidase-conjugated donkey anti-goat IgG antibody (Santa Cruz Biotechnology, Heidelberg, Germany) for the analysis of GLUT1 protein abundance in the cell membrane. Individual oocytes were placed in 20 e蘬 of SuperSignal ELISA Femto Maximum Sensitivity Substrate (Pierce, Rockford, IL), and chemiluminescence was quantified by luminometry by integrating the signal over a period of 1 s.
Western blotting.
To determine whole-cell GLUT1 and SGK1 expression in oocytes, transfected HEK-293 cells, and adipocytes, cells were homogenized in lysis buffer, and 30 e蘥 protein were separated on a 10% polyacrylamide gel and transferred to a nitrocellulose membrane. After blocking with 5% nonfat dry milk in PBS/0.15% Tween 20 for 1 h at room temperature, blots were incubated overnight at 4°C with a goat anti-GLUT1 antibody (diluted 1:100 in PBS/0.15% Tween 20/5% nonfat dry milk; Santa Cruz Biotechnology), a rabbit anti-SGK1 antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk; Upstate, Dundee, U.K.), or a rabbit antieCglyceraldehyde-3-phosphate dehydrogenase (GAPDH) horseradish peroxidaseeCconjugated antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk). GAPDH was used to demonstrate equal protein loading. Secondary peroxidase-conjugated donkey anti-goat IgG antibody (diluted 1:2000 in PBS/0.15% Tween 20/5% nonfat dry milk; Santa Cruz Biotechnology) or sheep anti-rabbit IgG antibody (diluted 1:1,000 in PBS/0.15% Tween 20/5% nonfat dry milk; Amersham, Freiburg, Germany) was used for chemiluminescent detection of GLUT1 or SGK1 with an enhanced chemiluminescence kit (Amersham), respectively. Band intensities were quantified using Quantity One Analysis software (Biorad, Munich, Germany).
Calculations.
Data are provided as means ± SE, and n represents the number of oocytes investigated. All experiments were repeated with at least three batches of oocytes. In all repetitions, qualitatively similar data were obtained. All data were tested for significance using ANOVA, and only results with P < 0.05, P < 0.01, and P < 0.005 were considered as statistically significant.
RESULTS
To investigate the role of SGK1 in the modulation of GLUT1 activity, GLUT1 was expressed in Xenopus laevis oocytes and glucose transport was measured in the presence and absence of the protein kinase. Tracer-flux studies revealed an increase in GLUT1 transport rate (177.1 ± 21.3% of control, n = 10, Fig. 1) upon coexpression of S422DSGK1. Glucose uptake into water-injected oocytes or oocytes expressing constitutively active S422DSGK1 alone was <6.3 ± 2.3% of control (n = 26eC37). GLUT1 upregulation by SGK1 was dependent on the catalytic activity of the kinase, as the inactive mutant K127NSGK1 did not significantly modify the transporter (70.6 ± 17.2% of control, n = 8).
To test whether SGK1 modulates GLUT1 uptake by phosphorylating GLUT1, the putative phosphorylation site at 95Ser in GLUT1 was mutated into alanine (S95AGLUT1). Disruption of the putative SGK phosphorylation site did not prevent GLUT1 stimulation by S422DSGK1 (239.8 ± 32.7% of control, n = 46), suggesting that the kinase is effective through phosphorylation of an intermediate protein (Fig. 2).
Some of the transporters modulated by SGKs (31,36,37) are indirectly regulated through phosphorylation and thus inhibition of the ubiquitin ligase Nedd4-2, which otherwise tags its target protein for degradation. To assess whether GLUT1 is modulated by Nedd4-2, the transporter was expressed in Xenopus oocytes and transport activity was measured in the presence and absence of the ubiquitin ligase. Nedd4-2 coexpression did not significantly affect GLUT1 activity (87.2 ± 7.8% of control, n = 15, Fig. 3). Thus, the ubiquitin ligase is apparently not involved in the regulation of GLUT1.
A detailed kinetic analysis of GLUT1 revealed that S422DSGK1 enhances GLUT1 by modifying the maximal transport rate, Vmax, without affecting substrate affinity (Fig. 4 and Table 1).
GLUT1 plasma membrane abundance was studied with or without SGK1 coexpression. Chemiluminescence experiments revealed that GLUT1 surface expression was higher in oocytes coexpressing S422DSGK1 (134.9 ± 12.8%, n = 50) than in oocytes expressing GLUT1 alone (n = 53, Fig. 5A). Thus, GLUT1 modulation by S422DSGK1 is due to increased transporter abundance in the plasma membrane. Enhanced GLUT1 plasma membrane expression is not due to induced GLUT1 de novo protein synthesis as indicated by western blotting of whole-cell lysates (Fig. 5B).
GLUT1 modulation by SGK1 was also observed in mammalian cells (HEK-293). HEK-293 cells were transfected with pIRES2EGFP-S422DSGK1, pIRES2EGFP-K127NSGK1, or with empty vector (as a control), and 2 days later 2-DOG uptake was measured in the presence and absence of GLUT1 inhibitor phloretin (0.1 mmol/l). Tracer-flux studies revealed an increase in GLUT1 transport rate (from 2.3 ± 0.6 [n = 3] to 5.1 ± 0.6 nmol · mineC1 · mg proteineC1 [n = 3], Fig. 6A) upon coexpression of S422DSGK1. As observed in Xenopus oocytes, GLUT1 upregulation by SGK1 was dependent on the catalytic activity of the kinase, as the effect was lacking upon expression of the catalytical inactive mutant K127NSGK1 (from 2.3 ± 0.6 [n = 3] to 1.8 ± 0.2 nmol · mineC1 · mg proteineC1 [n = 3]). Western blotting of whole-cell lysates indicated that the kinase fails to induce GLUT1 protein synthesis (Fig. 6B).
Kinetic analysis of 2-DOG uptake in transfected HEK-293 cells revealed that S422DSGK1 enhances GLUT1 by modifying the maximal transport rate, Vmax (from 17.7 ± 2.3 [n = 3] to 44.9 ± 4.4 nmol · mineC1 · mg proteineC1 [n = 3]), thereby corroborating the results obtained in the Xenopus oocyte expression system (Fig. 7 and Table 2).
Tracer-flux studies in adipocytes isolated from sgk1+/+ and sgk1eC/eC mice demonstrated the role of SGK1 in glucose transport regulation. As depicted in Fig. 8A, 2-DOG uptake was lower (55.67 ± 16.46%) in adipocytes isolated from sgk1eC/eC mice compared with sgk1+/+ mice despite similar total GLUT1 expression levels (Fig. 8B).
DISCUSSION
Similar to what has been shown for the Na+-coupled glucose transporter 1 (SGLT1) (31), SGK1 stimulates the facilitated glucose transporter GLUT1 by enhancing transporter abundance in the plasma membrane. The effect requires the catalytical activity of the kinase. SGK1 shuttles between cytoplasm and nucleus in a stimulus-dependent manner (38). The serum-induced nuclear import of SGK1 suggests that SGK1 acts at a transcriptional level. In fact, SGK1 has been shown to modulate the forkhead transcription factor FKHRL1 (39). Thus, SGK1 might regulate glucose transport in part by increasing GLUT1 transcript levels. However, the stimulation of glucose transport in Xenopus oocytes point to posttranscriptional regulation of GLUT1, as GLUT1 mRNA has been injected thus circumventing transcription. In addition, Western blotting of whole-cell lysates exclude GLUT1 regulation at a translational level.
SGK1 is not effective through phosphorylation of GLUT1, since the Ser-to-Ala mutation in the SGK consensus site failed to prevent SGK-mediated stimulation of glucose transport. Several channels and transporters are indirectly regulated through phosphorylation of the ubiquitin ligase Nedd4-2, which decreases the affinity of the enzyme to its target molecules and thus delays the clearance of the transport proteins from the cell membrane (31,36,37). As coexpression of Nedd4-2 did not alter GLUT1 activity, we exclude this mechanism of SGK action.
Phosphorylation-dependent events have previously been shown to modulate GLUT1 activity. Protein kinase C isozymes PKCII, -, and - stimulate GLUT1 by recruiting GLUT1 transporter to the cell membrane (40), and the AMP-activated protein kinase stimulates GLUT1 without affecting the total amount of GLUT1 protein at the cell surface (41). The AMP-activated protein kinase downstream target(s) have not yet been identified.
According to our results, SGK1 could play a similar role in the regulation of GLUT1 as PKB plays in the regulation of GLUT4. In some studies on adipocytes, constitutively active PKB has been able to upregulate GLUT4 but not GLUT1 (12). Insulin, however, upregulated both GLUT1 and GLUT4, and both effects were abrogated by inhibition of PI3 kinase (12). On the other hand, dominant inhibitory PKB has been shown to inhibit the insulin-mediated increase in GLUT1 protein abundance (42), and PKB has been reported to stimulate GLUT1 translocation to the cell membrane (43), suggesting a role of PKB in the regulation of GLUT1. Moreover, insulin may (12) or may not (44) stimulate GLUT1. Thus, the regulation of GLUT1 may depend on the experimental condition and may be supported by PKB and/or SGK1. It should be kept in mind that the transcription of SGK1 is highly variable and subject to a number of regulators (5), and thus SGK1-dependent effects may be similarly variable. GLUT1 modulation by SGK1 reported in this study is not restricted to the Xenopus oocyte expression system, as similar results were obtained in cultured mammalian cells. The observed reduced glucose transport in adipocytes isolated from sgk1eC/eC mice points to a physiological role of the kinase in glucose transport regulation.
SGK-dependent stimulation of GLUT1 transporters may be of relevance in the cellular uptake of glucose into several tissues including the brain and defective SGK dependent regulation of GLUT1 may contribute to the GLUT1 deficiency syndrome characterized by a defect in GLUT1 translocation to the plasma membrane (45). Notably, SGK1 expression is upregulated by cerebral ischemia (46) and may help to enhance cellular glucose uptake into the ischemic tissue. Moreover, the enhanced cerebral SGK1 expression in enriched environment (47) may serve to adjust glucose uptake to the enhanced demand following stimulation of neuronal activity. As a matter of fact, SGK1-dependent regulation of glucose transport is reflected by delayed glucose uptake into several tissues in the SGK1 knockout mouse following an intraperitoneal glucose tolerance test (K.M. Boini, A.M. Hennige, D.Y. Huang, B. Friedrich, M.P., C.B., F. Grahammer, F. Artunc, H. Osswald, P. Wulff, D. Kuhl, V. Vallon, H.U. Hring, F.L., unpublished observations).
In conclusion, the facilitated glucose transporter GLUT1 is modulated by the serum- and glucocorticoid-inducible kinase SGK1. The kinase stimulates GLUT1 by enhancing the transporter plasma membrane abundance and is effective through phosphorylation of a hitherto unknown intermediate protein. The SGK1-dependent regulation of GLUT1 may participate in the adjustment of cellular glucose uptake to the demand.
ACKNOWLEDGMENTS
This study was supported by the Deutsche Forschungsgemeinschaft (La 315/4-6), a Marie Curie Research Fellowship (QLGA-CT-2001-52014) to M.P., and a research grant (Nr. 1190D) from Damascus University to A.A.
The authors acknowledge the technical assistance of B. Noll and the meticulous preparation of the manuscript by T. Loch and L. Subasic.
REFERENCES
Cushman SW, Wardzala LJ: Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell: apparent translocation of intracellular transport systems to the plasma membrane. J Biol Chem 255:4758eC4762, 1980
James DE, Pilch PF: Fractionation of endocytic vesicles and glucose-transporter-containing vesicles in rat adipocytes. Biochem J 256:725eC732, 1988
Suzuki K, Kono T: Evidence that insulin causes translocation of glucose transport activity to the plasma membrane from an intracellular storage site. Proc Natl Acad Sci U S A 77:2542eC2545, 1980
Khan AH, Pessin JE: Insulin regulation of glucose uptake: a complex interplay of intracellular signalling pathways. Diabetologia 45:1475eC1483, 2002
Lang F, Cohen P: Regulation and physiological roles of serum- and glucocorticoid-induced protein kinase isoforms (Review). Sci STKE 2001:RE17, 2001
Virkamaki A, Ueki K, Kahn CR: Protein-protein interaction in insulin signaling and the molecular mechanisms of insulin resistance. J Clin Invest 103:931eC943, 1999
Cheatham B, Vlahos CJ, Cheatham L, Wang L, Blenis J, Kahn CR: Phosphatidylinositol 3-kinase activation is required for insulin stimulation of pp70 S6 kinase, DNA synthesis, and glucose transporter translocation. Mol Cell Biol 14:4902eC4911, 1994
Haruta T, Morris AJ, Rose DW, Nelson JG, Mueckler M, Olefsky JM: Insulin-stimulated GLUT4 translocation is mediated by a divergent intracellular signaling pathway. J Biol Chem 270:27991eC27994, 1995
Kotani K, Carozzi AJ, Sakaue H, Hara K, Robinson LJ, Clark SF, Yonezawa K, James DE, Kasuga M: Requirement for phosphoinositide 3-kinase in insulin-stimulated GLUT4 translocation in 3T3eCL1 adipocytes. Biochem Biophys Res Commun 209:343eC348, 1995
Okada T, Kawano Y, Sakakibara T, Hazeki O, Ui M: Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes: studies with a selective inhibitor wortmannin. J Biol Chem 269:3568eC3573, 1994
Perrini S, Natalicchio A, Laviola L, Belsanti G, Montrone C, Cignarelli A, Minielli V, Grano M, De Pergola G, Giorgino R, Giorgino F: Dehydroepiandrosterone stimulates glucose uptake in human and murine adipocytes by inducing GLUT1 and GLUT4 translocation to the plasma membrane. Diabetes 53:41eC52, 2004
Foran PG, Fletcher LM, Oatey PB, Mohammed N, Dolly JO, Tavare JM: Protein kinase B stimulates the translocation of GLUT4 but not GLUT1 or transferrin receptors in 3T3eCL1 adipocytes by a pathway involving SNAP-23, synaptobrevin-2, and/or cellubrevin. J Biol Chem 274:28087eC28095, 1999
Zhou QL, Park JG, Jiang ZY, Holik JJ, Mitra P, Semiz S, Guilherme A, Powelka AM, Tang X, Virbasius J, Czech MP: Analysis of insulin signalling by RNAi-based gene silencing. Biochem Soc Trans 32:817eC821, 2004
Webster MK, Goya L, Ge Y, Maiyar AC, Firestone GL: Characterization of sgk, a novel member of the serine/threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum. Mol Cell Biol 13:2031eC2040, 1993
Waldegger S, Barth P, Raber G, Lang F: Cloning and characterization of a putative human serine/threonine protein kinase transcriptionally modified during anisotonic and isotonic alterations of cell volume. Proc Natl Acad Sci U S A 94:4440eC4445, 1997
Kobayashi T, Deak M, Morrice N, Cohen P: Characterization of the structure and regulation of two novel isoforms of serum- and glucocorticoid-induced protein kinase. Biochem J 344:189eC197, 1999
Alessi DR, Andjelkovic M, Caudwell B, Cron P, Morrice N, Cohen P, Hemmings BA: Mechanism of activation of protein kinase B by insulin and IGF-1. EMBO J 15:6541eC6551, 1996
Park J, Leong ML, Buse P, Maiyar AC, Firestone GL, Hemmings BA: Serum and glucocorticoid-inducible kinase (SGK) is a target of the PI 3-kinase-stimulated signaling pathway. EMBO J 18:3024eC3033, 1999
Buse P, Tran SH, Luther E, Phu PT, Aponte GW, Firestone GL: Cell cycle and hormonal control of nuclear-cytoplasmic localization of the serum- and glucocorticoid-inducible protein kinase, Sgk, in mammary tumor cells: a novel convergence point of anti-proliferative and proliferative cell signaling pathways. J Biol Chem 274:7253eC7263, 1999
Kobayashi T, Cohen P: Activation of serum- and glucocorticoid-regulated protein kinase by agonists that activate phosphatidylinositide 3-kinase is mediated by 3-phosphoinositide-dependent protein kinase-1 (PDK1) and PDK2. Biochem J 339:319eC328, 1999
Perrotti N, He RA, Phillips SA, Haft CR, Taylor SI: Activation of serum- and glucocorticoid-induced protein kinase (Sgk) by cyclic AMP and insulin. J Biol Chem 276:9406eC9412, 2001
Bell LM, Leong ML, Kim B, Wang E, Park J, Hemmings BA, Firestone GL: Hyperosmotic stress stimulates promoter activity and regulates cellular utilization of the serum- and glucocorticoid-inducible protein kinase (Sgk) by a p38 MAPK-dependent pathway. J Biol Chem 275:25262eC25272, 2000
Lang F, Ritter M, Gamper N, Huber S, Fillon S, Tanneur V, Lepple-Wienhues A, Szabo I, Gulbins E: Cell volume in the regulation of cell proliferation and apoptotic cell death. Cell Physiol Biochem 10:417eC428, 2000
Setiawan I, Henke G, Feng Y, Bohmer C, Vasilets LA, Schwarz W, Lang F: Stimulation of Xenopus oocyte Na(+),K(+)ATPase by the serum and glucocorticoid-dependent kinase sgk1. Pflugers Arch 444:426eC431, 2002
Zecevic M, Heitzmann D, Camargo SM, Verrey F: SGK1 increases Na,K-ATP cell-surface expression and function in Xenopus laevis oocytes. Pflugers Arch 448:29eC35, 2004
Boehmer C, Embark HM, Bauer A, Palmada M, Yun CH, Weinman EJ, Endou H, Cohen P, Lahme S, Bichler KH, Lang F: Stimulation of renal Na+ dicarboxylate cotransporter 1 by Na+/H+ exchanger regulating factor 2, serum and glucocorticoid inducible kinase isoforms, and protein kinase B. Biochem Biophys Res Commun 313:998eC1003, 2004
Boehmer C, Okur F, Setiawan I, Broer S, Lang F: Properties and regulation of glutamine transporter SN1 by protein kinases SGK and PKB. Biochem Biophys Res Commun 306:156eC162, 2003
Boehmer C, Henke G, Schniepp R, Palmada M, Rothstein JD, Broer S, Lang F: Regulation of the glutamate transporter EAAT1 by the ubiquitin ligase Nedd4-2 and the serum and glucocorticoid-inducible kinase isoforms SGK1/3 and protein kinase B. J Neurochem 86:1181eC1188, 2003
Schniepp R, Kohler K, Ladewig T, Guenther E, Henke G, Palmada M, Boehmer C, Rothstein JD, Broer S, Lang F: Retinal colocalization and in vitro interaction of the glutamate transporter EAAT3 and the serum- and glucocorticoid-inducible kinase SGK1. Invest Ophthalmol Vis Sci 45:1442eC1449, 2004 [correction]
Bohmer C, Philippin M, Rajamanickam J, Mack A, Broer S, Palmada M, Lang F: Stimulation of the EAAT4 glutamate transporter by SGK protein kinase isoforms and PKB. Biochem Biophys Res Commun 324:1242eC1248, 2004
Dieter M, Palmada M, Rajamanickam J, Aydin A, Busjahn A, Boehmer C, Luft FC, Lang F: Regulation of glucose transporter SGLT1 by ubiquitin ligase Nedd4-2 and kinases SGK1, SGK3, and PKB. Obes Res 12:862eC870, 2004
Lang F, Henke G, Embark HM, Waldegger S, Palmada M, Bohmer C, Vallon V: Regulation of channels by the serum and glucocorticoid-inducible kinase: implications for transport, excitability and cell proliferation. Cell Physiol Biochem 13:41eC50, 2003
Keller K, Mueckler M: Different mammalian facilitative glucose transporters expressed in Xenopus oocytes. Biomed Biochim Acta 49:1201eC1203, 1990
Wagner CA, Friedrich B, Setiawan I, Lang F, Broer S: The use of Xenopus laevis oocytes for the functional characterization of heterologously expressed membrane proteins. Cell Physiol Biochem 10:1eC12, 2000
Ruan H, Zarnowski MJ, Cushman SW, Lodish HF: Standard isolation of primary adipose cells from mouse epididymal fat pads induces inflammatory mediators and down-regulates adipocyte genes. J Biol Chem 278:47585eC47593, 2003
Debonneville C, Flores SY, Kamynina E, Plant PJ, Tauxe C, Thomas MA, Munster C, Chraibi A, Pratt JH, Horisberger JD, Pearce D, Loffing J, Staub O: Phosphorylation of Nedd4-2 by Sgk1 regulates epithelial Na(+) channel cell surface expression. EMBO J 20:7052eC7059, 2001
Palmada M, Dieter M, Speil A, Bohmer C, Mack AF, Wagner HJ, Klingel K, Kandolf R, Murer H, Biber J, Closs EI, Lang F: Regulation of intestinal phosphate cotransporter NaPi IIb by ubiquitin ligase Nedd4-2 and by serum- and glucocorticoid-dependent kinase 1. Am J Physiol Gastrointest Liver Physiol 287:G143eCG150, 2004
Firestone GL, Giampaolo JR, O’Keeffe BA: Stimulus-dependent regulation of the serum and glucocorticoid inducible protein kinase (Sgk) transcription, subcellular localization and enzymatic activity. Cell Physiol Biochem 13:1eC12, 2003
Brunet A, Park J, Tran H, Hu LS, Hemmings BA, Greenberg ME: Protein kinase SGK mediates survival signals by phosphorylating the forkhead transcription factor FKHRL1 (FOXO3a). Mol Cell Biol 21:952eC965, 2001
Cooper DR, Watson JE, Patel N, Illingworth P, Acevedo-Duncan M, Goodnight J, Chalfant CE, Mischak H: Ectopic expression of protein kinase CbetaII, -delta, and -epsilon, but not -betaI or -zeta, provide for insulin stimulation of glucose uptake in NIH-3T3 cells. Arch Biochem Biophys 372:69eC79, 1999
Barnes K, Ingram JC, Porras OH, Barros LF, Hudson ER, Fryer LG, Foufelle F, Carling D, Hardie DG, Baldwin SA: Activation of GLUT1 by metabolic and osmotic stress: potential involvement of AMP-activated protein kinase (AMPK). J Cell Sci 115:2433eC2442, 2002
Taha C, Liu Z, Jin J, Al Hasani H, Sonenberg N, Klip A: Opposite translational control of GLUT1 and GLUT4 glucose transporter mRNAs in response to insulin: role of mammalian target of rapamycin, protein kinase b, and phosphatidylinositol 3-kinase in GLUT1 mRNA translation. J Biol Chem 274:33085eC33091, 1999
Rathmell JC, Fox CJ, Plas DR, Hammerman PS, Cinalli RM, Thompson CB: Akt-directed glucose metabolism can prevent Bax conformation change and promote growth factor-independent survival. Mol Cell Biol 23:7315eC7328, 2003
Houdali B, Nguyen V, Ammon HP, Haap M, Schechinger W, Machicao F, Rett K, Haring HU, Schleicher ED: Prolonged glucose infusion into conscious rats inhibits early steps in insulin signalling and induces translocation of GLUT4 and protein kinase C in skeletal muscle. Diabetologia 45:356eC368, 2002
Klepper J, Voit T: Facilitated glucose transporter protein type 1 (GLUT1) deficiency syndrome: impaired glucose transport into brain: a review. Eur J Pediatr 161:295eC304, 2002
Nishida Y, Nagata T, Takahashi Y, Sugahara-Kobayashi M, Murata A, Asai S: Alteration of serum/glucocorticoid regulated kinase-1 (sgk-1) gene expression in rat hippocampus after transient global ischemia. Brain Res Mol Brain Res 123:121eC125, 2004
Lee EH, Hsu WL, Ma YL, Lee PJ, Chao CC: Enrichment enhances the expression of sgk, a glucocorticoid-induced gene, and facilitates spatial learning through glutamate AMPA receptor mediation. Eur J Neurosci 18:2842eC2852, 2003(Monica Palmada, Christoph)