BETA2/NeuroD Protein Can Be Transduced Into Cells Due to an Arginine- and Lysine-Rich Sequence
http://www.100md.com
糖尿病学杂志 2005年第10期
1 Department of Transplantation and Immunology, Kyoto University Graduate School of Medicine, Kyoto, Japan
2 Section on Islet Transplantation and Cell Biology, Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts
3 Department of Physiology, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan
4 Transplantation Unit, Kyoto University Hospital, Kyoto, Japan
ABSTRACT
BETA2/NeuroD, a basic helix-loop-helix transcription factor, is a key regulator of pancreatic islet morphogenesis and insulin gene transcription. Here we report for the first time that the BETA2/NeuroD protein can permeate several cells, including pancreatic islets, due to an arginine- and lysine-rich protein transduction domain sequence in its structure. The BETA2/NeuroD protein was transduced in a dose-dependent manner up to 1 e蘭ol/l. Transduced BETA2/NeuroD functions similarly to endogenous BETA2/NeuroD: it binds to the insulin promoter and activates its expression. We also investigated the mechanism of BETA2/NeuroD protein transduction. The BETA2/NeuroD protein penetrated cells by macropinocytosis and was released from endosomes homogeneously in cytoplasm and nuclei. These data suggest that BETA2/NeuroD protein transduction could be a safe and valuable strategy for enhancing insulin gene transcription without requiring gene transfer technology.
Basic helix-loop-helix (bHLH) proteins are transcription factors involved in the specification of cell type and differentiation during development (1eC3). The BETA2/NeuroD protein, a class B bHLH factor, has been cloned as both a transcriptional activator of the insulin gene (4) and a neurogenic factor in Xenopus embryos (2). BETA2/NeuroD is expressed transiently in a subset of neurons in the central and peripheral nervous systems at the time of their terminal differentiation (2). Moreover, this protein is important for regulating insulin gene transcription (4) and for the terminal differentiation of islet cells, including insulin- and glucagon-producing cells. In BETA2/NeuroD gene-targeting experiments, mutant mice developed severe diabetes with ketoacidosis and died perinatally (5).
Since the discovery of protein transduction domains (PTDs), which allow proteins to be translocated across the plasma membrane and into nuclei, there has been increasing interest in their potential to deliver bioactive peptides and proteins into eukaryotic cells as a valuable strategy for the transduction of therapeutic proteins into patients. The small PTDs from the TAT protein of HIV-1 (6,7), the VP22 protein of Herpes simplex virus (8), and the Antennapedia homeoprotein of Drosophila (9) have been fused to proteins, resulting in the remarkable delivery of proteins into many mammalian tissues.
Recently, we and others have shown that the important sequences in protein transduction are arginine and lysine (10eC12). We have noticed that the transcription factor BETA2/NeuroD protein has an arginine- and lysine-rich sequence that is conserved across species (mice, rats, and humans) (Fig. 1A). The presence of a PTD in BETA2/NeuroD is intriguing, given that BETA2/NeuroD plays such an important role in islet cell differentiation and survival, islet morphogenesis, and the maintenance of normal -cell function due to its regulation of insulin genes (4). Clinically, mutations in BETA2/NeuroD result in both type 1 and 2 diabetes, including maturity-onset diabetes of the young (13eC16). BETA2/NeuroD expression and its DNA binding activity are reduced in association with decreased insulin gene expression in several diabetic models (17,18).
Here we report for the first time that the BETA2/NeuroD protein can permeate cells due to an arginine- and lysine-rich sequence in its structure and that transduced BETA2/NeuroD functions similarly to endogenous BETA2/NeuroD.
RESEARCH DESIGN AND METHODS
Construction of BETA2/NeuroD protein vectors and purification of recombinant BETA2/NeuroD proteins.
Full-length BETA2/NeuroD cDNA was amplified by PCR using appropriate linker-primers and then subcloned into the Nde I and Xho I sites of pET21b(+) (Novagen, Madison, WI) using a ligation kit (TaKaRa, Tokyo, Japan). On mutant plasmids, sequences before and after each deletion were amplified by PCR using appropriate linker-primers and were then subcloned into the Nde IeCHindIII and HindIIIeCXho I sites of pET21b(+), respectively. BL21 (DE3) cells containing the expression plasmids were grown at 37°C to an optical density 600 of 0.8. Isopropyl--D-thiogalactopyranoside was added to a final concentration of 0.1 mmol/l, and the cells were then incubated for 12 h at 24°C. Cells were sonicated and the supernatants were recovered and applied to a column of Ni-nitrilotriacetic acid agarose (Invitrogen, San Diego, CA). Purified BETA2/NeuroD proteins were conjugated using a Cy5-labeling kit (Amersham Pharmacia, Piscataway, NJ).
Isolation and culture of rat pancreatic islets.
Islets were isolated from the pancreases of anesthetized male SD rats (200eC250 g; Taconic Farms, Germantown, NY). All animal procedures were approved by the review committee of Kyoto University Graduate School of Medicine. The common bile duct was cannulated and injected with 6 ml cold M199 medium containing 1.5 mg/ml collagenase (Roche Boehringer Mannheim, Indianapolis, IN). The islets were separated on Histopaque 1077 (Sigma, St. Louis, MO) density gradient, hand picked under a dissecting microscope to ensure a pure islet preparation, and used immediately afterward. In these experiments, islets were cultured in RPMI medium with 10% FCS.
Western blotting.
Western blotting was conducted in accordance with the method described previously (19). In brief, after being washed three times with PBS and high salt buffer, cells were scraped from the dish and sonicated. Then 10 e蘥 of cell extracts were fractionated by 10% SDS-PAGE and transferred to polyvinylidine fluoride membranes (Immun-Blot PVDF Membrane; Bio-RAD, Hercules, CA) using a transfer buffer containing 20% methanol, 25 mmol/l Tris base, and 192 mmol/l glycine (300 mA, 2 h). After being blocked at room temperature for 1 h in 50 mmol/l Tris-HCl, 150 mmol/l NaCl, and 0.1% Tween-20 (TBST) with 5% nonfat dry milk, the membranes were incubated overnight at 4°C in TBST using 5% nonfat dry milk containing goat antieCBETA2/NeuroD antibody (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-actin antibody (1:1,000; Sigma), or horseradish peroxidaseeCconjugated antieC6 histidine antibody (1:5,000; Invitrogen). For antieCBETA2/NeuroD antibody or anti-actin antibody, the membranes were then incubated for 1 h at room temperature in TBST with 5% nonfat dry milk containing anti-goat or anti-mouse IgG antibody coupled to horseradish peroxidase (1:1,000; Bio-Rad).
Gel-mobility shift assay.
For this assay, 2 e蘥 nuclear extract were incubated with 2 e蘥 poly (dI-dC), 25 mmol/l HEPES (pH 7.8), 0.2 mmol/l EDTA, 150 mmol/l KCl, 5 mmol/l dithiothreitol, and 9% glycerol at room temperature. The binding reaction was initiated by adding 32P-labeled double-stranded oligonucleotide probes. A double-stranded oligonucleotide reproducing the rat insulin gene BETA2/NeuroDeCbinding region (E-box) and surrounding sequences (ACGTTCTGGCCATCTGCTGAT CCTACGT; E-box in italics) or E-boxeCmutated sequences (ACGTTCTGGCTTTCCCCTGAT CCTACGT) (Sigma Genosys, Woodlands, TX) was used as a binding probe. In some binding assays, antieCBETA2/NeuroD, antieC6 histidine antibody, and preimmune antisera were added to the reaction mixture 1 h before DNA probes were added.
Gene transfection and luciferase assay.
A rat insulin II promoter-reporter (luciferase) plasmid (1.0 e蘥) containing 238-bp 5'-flanking sequences of the rat insulin II promoter region (20) or E-boxeCmutated insulin II promoter-reporter plasmid (1.0 e蘥) (18) was transfected into cells with LipofectAMINE (Invitrogen) using the conditions recommended by the manufacturer. Then 48 h after the transfection, the cells were harvested and assayed (Promega, Madison, WI).
Fluorescein isothiocyanateeCconjugated BETA2/NeuroD PTD.
Fluorescein isothiocyanate (FITC)eCconjugated BETA2/NeuroD PTD peptide was synthesized by Sigma Genosys-Japan. The peptide was purified by preparative reversed-phase high-performance liquid chromatography, was confirmed as >95% pure as analyzed by high-performance liquid chromatography, and had the expected amino acid composition and mass spectra.
Treatment with FITCeCBETA2/NeuroD PTD and FM4eC64.
Cervix-derived HeLa cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FCS and penicillin-streptomycin. Cells were treated with 1 e蘭ol/l BETA2/NeuroD PTD for the specified time and then washed with fresh medium. To evaluate endocytosis, cells were incubated with 1 e蘭ol/l FITCeCBETA2/NeuroD PTD and 10 e蘭ol/l FM 4eC64 (Molecular Probes, Eugene, OR), a marker of endocytosis. Treated living cells were analyzed by conventional fluorescence microscopy and confocal microscopy.
Treatment with a plasmid expressing a dominant-negative mutant of dynamin.
HeLa cells were transfected with a plasmid expressing a dominant-negative mutant of dynamin-1 (DynDN), Discosoma sp. red fluorescent protein (DsRed), as previously described (21). After 24 h, cells were washed and treated with 1 e蘭ol/l FITCeCBETA2/NeuroD PTD in complete medium. After cells were incubated overnight, the FITC and DsRed signals were examined.
Treatment with amiloride and cytochalasin D.
To measure the mechanism of BETA2/NeuroD internalization, HeLa cells were plated and cultured in Dulbecco’s modified Eagle’s medium with 10% FBS. Cells were then pretreated for 10 or 30 min in serum-free medium with 5 mmol/l amiloride (Sigma) or 10 e蘭ol/l cytochalasin D (Sigma), respectively. After the BETA2/NeuroD PTD was added, cells were maintained for 1 h in the presence of inhibitors, washed several times, and incubated for 1 h in complete medium.
RESULTS
Transduction of the BETA2/NeuroD protein into cells.
To test whether the purified BETA2/NeuroD protein can be transduced into cells, cervix-derived HeLa, liver-derived HepG2, -celleCderived HIT-T15 cells, and primary rat islets and duct cells were treated with Cy5-conjugated BETA2/NeuroD protein. Then 6 h after this treatment, BETA2/NeuroD was observed as a fluorescence signal in primary islets, duct cells, HIT-T15, HepG2 (Fig. 1B), and HeLa cell lines (Fig. 2C1). Although it has previously been shown that some homeoprotein transcription factors can enter a large number of cell types (9,20eC22), our results showed that the BETA2/NeuroD protein, a bHLH transcription factor, is delivered into cells without requiring any additional sequences.
Protein transduction domain of BETA2/NeuroD protein.
To clarify the location of the PTD of BETA2/NeuroD, we made several Cy5-conjugated deletion proteins (Fig. 2A and B). Full-length BETA2/NeuroD protein and deletion BETA2/NeuroD (dNeuroD)-2, -4, -7, -8, and -9, but not the other dNeuroDs, could be transduced into HeLa cells (Fig. 2C and D). Both dNeuroD-8 and -9 proteins could be transduced into cells, but the Cy5 signals were weaker than that with full-length protein treatment (Fig. 2C). These data show that the 34 amino acids of the putative BETA2/NeuroD PTD are necessary for the BETA2/NeuroD protein to be efficiently transduced into cells (Fig. 3A). As we and others have recently shown, the sequences of BETA2/NeuroD protein are rich in arginine and lysine (10eC12).
Transduction efficiency of the BETA2/NeuroD PTD.
To test the transduction efficiency of the PTD of BETA2/NeuroD, we made enhanced green fluorescent protein (EGFP)eCfused PTDs. EGFP with 11 arginine (11R) PTD, the most effective protein transduction domain (10,11), and EGFP without PTD were used as positive and negative controls, respectively (Figs. 3A and B). HeLa cells were treated with these EGFP proteins for 6 h and analyzed by Western blotting (Fig. 3C) and confocal microscopy (Fig. 3D). The transduction efficiency of the full-length BETA2/NeuroD PTD was similar to that of the 11R PTD, whereas the efficiency of the partial sequence of the PTD was about half that of the 11R PTD (Figs. 3C and D). These data show that the transduction efficiency of BETA2/NeuroD PTD is as strong as that of 11R PTD.
Dose-dependent transduction of BETA2/NeuroD and the stability of transduced BETA2/NeuroD protein.
To test the effectiveness of transduced BETA2/NeuroD, HeLa cells were treated with the BETA2/NeuroD protein at several concentrations for 2 h, washed with PBS, incubated with conventional medium, and analyzed by Western blotting (Fig. 4A). The BETA2/NeuroD protein was transduced in a dose-dependent manner up to 1 e蘭ol/l. To determine the stability of the BETA2/NeuroD protein, HeLa cells were treated with 1 e蘭ol/l BETA2/NeuroD for 2 h, washed with PBS, incubated with conventional medium for 1eC46 h, and analyzed by Western blotting. The half-life of BETA2/NeuroD was 5 h (Fig. 4B). In addition, the transduced BETA2/NeuroD could be detected using an antibody to the histidine tag included in this synthesized protein.
Effects of transduced BETA2/NeuroD on clonal cells.
The insulin-enhancer element E-box is the binding site for BETA2/NeuroD and plays an important role in the regulation of insulin gene transcription (4,17,18). We therefore used a gel shift assay to test whether the transduced BETA2/NeuroD protein binds to the insulin-enhancer element. HeLa cells were treated with 1 e蘭ol/l BETA2/NeuroD protein, dNeuroD-6 (PTD-deleted BETA2/NeuroD protein), and EGFP with BETA2/NeuroD PTD (EGFP-PTD) for 24 h. The nuclear extract of HIT-T15 cells was used as a positive control. The E-box binding complex, but not the mutated E-box, was observed in nuclear extracts from treated HeLa cells. The specificity of the band was confirmed by its supershift with BETA2/NeuroD antibody and antieC6 histidine antibody but not by preimmune serum (Fig. 5A).
To test whether transduced BETA2/NeuroD protein can activate insulin gene transcription, we examined its effect on insulin promoter activity using a luciferase assay. HeLa cells were transfected with an insulin promotereCluciferase plasmid and allowed to grow for 24 h; they were then treated with 1 e蘭ol/l BETA2/NeuroD protein, dNeuroD-6, and EGFP-PTD for an additional 24 h, after which a luciferase assay was performed. Insulin promoter activity was increased by treatment with BETA2/NeuroD protein in HeLa cells (Fig. 5B) but not by treatment with dNeuroD-6 or EGFP-PTD. Mutated insulin promoter activity was not significantly changed by any treatment. Taken together, these results suggest that exogenous BETA2/NeuroD protein can be transduced into cells and their nuclei, bind to the E-box, and activate the insulin promoter.
Transduction of BETA2/NeuroD protein by endocytosis.
To investigate the mechanism of BETA2/NeuroD protein transduction, HeLa cells were treated with FITC-conjugated BETA2/NeuroD PTD and FM 4eC64, a marker of endocytosis, for 30 min and then washed with fresh media. The PTD fluorescence signal appeared as punctate within living, unfixed HeLa cells. This punctate PTD mainly co-localized with FM 4eC64 in living cells (Fig. 6A). After an additional 90 min, the PTD was homogeneously distributed in the cytosol and nuclei of some cells, whereas the FM dye remained in the endosome (Fig. 6A). These data show that the cellular uptake of BETA2/NeuroD PTD occurs through electrostatic interaction with the plasma membrane, subsequent endocytosis, and escape from the endosome with eventual homogeneous distribution in the cytoplasm.
BETA2/NeuroD protein transduction is independent of phagocytosis or clathrin- or caveolar-mediated endocytosis.
It was then determined whether the cellular uptake of BETA2/NeuroD occurs through a specific endocytic pathway. Multiple forms of endocytosis, including phagocytosis and clathrin- and caveolar-mediated endocytosis, require dynamin GTPase activity for vesicle formation at the cell surface. The expression of DynDN effectively blocks these endocytic pathways (21,23). We transfected cells with the DynDN-DsRed plasmid, treated the cells with FITC-conjugated BETA2/NeuroD PTD 24 h after transfection, and analyzed FITC signals at 48 h. The expression of DynDN did not block BETA2/NeuroD PTD uptake and recombination (Fig. 6B). These observations show that the BETA2/NeuroD internalization process does not involve caveolar- or clathrin-mediated endocytosis.
BETA2/NeuroD protein enters cells by lipid raft macropinocytosis.
Recently, it was reported that PTD-mediated cellular entry occurs by macropinocytosis (7,21). Macropinocytosis is a rapid, lipid rafteCdependent, and receptor-independent form of endocytosis. It requires actin membrane protrusions that envelope vesicles, termed macropinosomes (23). To examine the involvement of macropinocytosis in transduction, cells were pretreated with amiloride, a specific inhibitor of the Na+/H+ exchange required for macropinocytosis (24), or cytochalasin D, an F-actin elongation inhibitor (25). Pretreated cells were then incubated with BETA2/NeuroD PTD for 1 h and washed with complete medium. Cell treatment with either macropinosome inhibitor resulted in the reduction of BETA2/NeuroD PTD transduction into vesicles with no cytotoxicity (Fig. 7A). Taken together, these observations showing rapid transduction into cells, dynamin-1 independence, and uptake inhibition by amiloride and cytochalasin D, indicate that BETA2/NeuroD PTDeCmediated cellular entry occurs by lipid rafteCmediated macropinocytosis.
Impact of bafilomycin A1 or brefeldin A on the cellular distribution of BETA2/NeuroD PTD.
Bafilomycin A1 is a highly potent and selective inhibitor of vacuolar H+ ATPases and inhibits endosomal acidification (26). The effect of bafilomycin A1 on the intracellular localization of the peptide was tested: 30 min before the PTD peptide was added, cells were washed once and then 300 nmol/l bafilomycin was added to the medium. After a 2-h incubation with BETA2/NeuroD PTD, no cytoplasmic fluorescence was present and only vesicular staining was observed (Fig. 7B). These data show that the release of PTD into the cytosol occurs by a mechanism dependent on endosomal acidification and preserved endosomal integrity.
We next addressed the potential involvement of the Golgi complex in the cellular trafficking of BETA2/NeuroD PTD. Brefeldin A interferes with the integrity of the Golgi and trans-Golgi network and affects the uptake of the TAT fusion protein (27). In this study, cells were washed once and 20 e蘭ol/l brefeldin A was added 30 min before the peptide was introduced. After a 2-h incubation with the peptide, the cellular fluorescence of BETA2/NeuroD PTD was reduced (Fig. 7B), similar to what was seen with bafilomycin A1. Taken together, these data suggest that the BETA2/NeuroD protein penetrated cells by macropinocytosis and entered the cytoplasm by means of retrograde transport (Fig. 8).
DISCUSSION
PTDs are a series of small domains that have been shown to cross biological membranes efficiently, independently of transporters or specific receptors, and promote the delivery of full-length proteins in a rapid and concentration-dependent fashion into a large number of cells. These PTDs are arginine- and lysine-rich sequences, especially the TAT PTD. We and others have shown that proteins with fused polyarginine or polylysine sequences can permeate several cell types even more efficiently (10eC12,28). It has also been shown that >40% of lysine- and arginine-rich peptides within 11eC16 amino acids can permeate cells (29). BETA2/NeuroD has arginine- and lysine-rich sequences in its own sequence and the arginine and lysine content is 53% over 34 amino acids.
BETA2/NeuroD is selectively expressed in the developing endocrine pancreas, the small intestine, and the nervous system (2) and plays an important role in maintaining the differentiation of endocrine cells, proper islet morphogenesis, and normal cell function, especially -cell function, by regulating the insulin gene (4,5). Mice with an inactivated BETA2/NeuroD gene die of severe diabetes caused by a major reduction in the number of -cells and a lack of proper islet formation (4). BETA2/NeuroD strongly stimulates DNA-binding capacity by heterodimerization with class A bHLH proteins, such as the ubiquitous E47. The PTD of BETA2/NeuroD includes the DNA-binding region of the bHLH factor. Thus the 34 amino acids of BETA2/NeuroD PTD are extremely important in several other aspects of its function.
Because the DNA-binding domain is conserved between different bHLH proteins (Fig. 8B, underlined), most, but not all, bHLH proteins could be transduced into cells. However, transduction efficiency is extremely different between each bHLH protein because sequences before the DNA binding domain are quite different. Neurogenin 3 and myogenic determination factor could be transduced into cells, but the efficiency is less than that of the BETA2/NeuroD protein (H.N., M.M., unpublished observations). E47 is hardly transduced into cells.
Our study showed that BETA2/NeuroD protein has a native PTD and, without modification, can permeate several cell types and enhance insulin promoter activity in these cells. In the insulin promoter, E-boxes, corresponding to the consensus CANNTG, are the binding site of heterodimer E47/BETA2 and are juxtaposed to AT-rich elements (A-box) that bind pancreatic duodenal homeobox 1 (PDX-1). The synergistic activation of cis-elements is observed between BETA2 and PDX-1 (30,31). Moreover, these two proteins are important in pancreatic development (5,32). We have reported that the PDX-1 protein can transduce cells because of its own Antennapedia-like protein and that PDX-1 protein induces insulin expression in pancreatic ductal cells, thought to be islet progenitor cells (20). The exogenous BETA2/NeuroD protein also induces insulin expression in pancreatic ductal progenitor cells (H.N., S.M., unpublished observations). The BETA2/NeuroD gene has E-boxes, and the BETA2/NeuroD protein could stimulate its own transcription (33). Furthermore, the pdx-1 gene has A-boxes, and the PDX-1 protein could positively autoregulate its expression (34). Once the BETA2/NeuroD and PDX-1 proteins are transduced into progenitor cells, endogenous BETA2/NeuroD and pdx-1 gene transcription are amplified by these proteins, stimulate insulin transcription, and may facilitate their differentiation into insulin-producing cells. Our finding of a functional PTD in transcription factor BETA2/NeuroD suggests that exogenous BETA2/NeuroD could be a novel approach for generating surrogate -cells without requiring gene transfer technology.
ACKNOWLEDGMENTS
H.N. is a Research Fellow of the Japan Society for the Promotion of Science, Kyoto University Graduate School of Medicine.
We thank Dr. Susumu Seino (Kobe University) and Kotaro Minami (Kyoto University) for materials.
bHLH, basic helix-loop-helix; dNeuroD, deletion BETA2/NeuroD; dNeuroD-6, PTD-deleted BETA2/NeuroD protein; DsRed, Discosoma sp. red fluorescent protein; DynDN, dominant-negative mutant of dynamin-1; EGFP, enhanced green fluorescent protein; EGFP-PTD, EGFP with BETA2/NeuroD PTD; FITC, fluorescein isothiocyanate; PDX-1, pancreatic duodenal homeobox 1; PTD, protein transduction domain; TBST, Tris-buffered saline with Tween
REFERENCES
Bang AG, Goulding MD: Regulation of vertebrate neural cell fate by transcription factors. Curr Opin Neurobiol6 :25 eC32,1996
Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H: Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science268 :836 eC844,1995
Olson EN, Klein WH: bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out. Genes Dev8 :1 eC8,1994
Naya FJ, Stellrecht CM, Tsai MJ: Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev9 :1009 eC1019,1995
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev11 :2323 eC2334,1997
Schwarze SR, Ho A, Vocero-Akbani A, Dowdy SF: In vivo protein transduction: delivery of a biologically active protein into the mouse. Science285 :1569 eC1572,1999
Wadia JS, Stan RV, Dowdy SF: Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat Med10 :310 eC315,2004
Elliott G, O’Hare P: Intercellular trafficking and protein delivery by a herpes virus structural protein. Cell88 :223 eC233,1997
Joliot A, Prochiantz A: Transduction peptides: from technology to physiology. Nat Cell Biol6 :189 eC196,2004
Matsushita M, Tomizawa K, Moriwaki A, Li ST, Terada H, Matsui H: A high-efficiency protein transduction system demonstrating the role of PKA in long-lasting long-term potentiation. J Neurosci21 :6000 eC6007,2001
Matsui H, Tomizawa K, Lu YF, Matsushita M: Protein therapy: in vivo protein transduction by polyarginine (11R) PTD and subcellular targeting delivery. Curr Protein Pept Sci4 :151 eC157,2003
Noguchi H, Matsushita M, Okitsu T, Moriwaki A, Tomizawa K, Kang S, Li ST, Kobayashi N, Matsumoto S, Tanaka K, Tanaka N, Matsui H: A new cell-permeable peptide allows successful allogeneic islet transplantation in mice. Nat Med10 :305 eC309,2004
Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet23 :323 eC328,1999
Kristinsson SY, Thorolfsdottir ET, Talseth B, Steingrimsson E, Thorsson AV, Helgason T, Hreidarsson AB, Arngrimsson R: MODY in Iceland is associated with mutations in HNF-1alpha and a novel mutation in NeuroD1. Diabetologia44 :2098 eC2103,2001
Iwata I, Nagafuchi S, Nakashima H, Kondo S, Koga T, Yokogawa Y, Akashi T, Shibuya T, Umeno Y, Okeda T, Shibata S, Kono S, Yasunami M, Ohkubo H, Niho Y: Association of polymorphism in the NeuroD/BETA2 gene with type 1 diabetes in the Japanese. Diabetes48 :416 eC419,1999
Hansen L, Jensen JN, Urioste S, Petersen HV, Pociot F, Eiberg H, Kristiansen OP, Hansen T, Serup P, Nerup J, Pedersen O: NeuroD/BETA2 gene variability and diabetes: no associations to late-onset type 2 diabetes but an A45 allele may represent a susceptibility marker for type 1 diabetes among Danes: Danish Study Group of Diabetes in Childhood and the Danish IDDM Epidemiology and Genetics Group. Diabetes49 :876 eC878,2000
Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J Biol Chem274 :14112 eC14121,1999
Kaneto H, Sharma A, Suzuma K, Laybutt DR, Xu G, Bonner-Weir S, Weir GC: Induction of c-Myc expression suppresses insulin gene transcription by inhibiting NeuroD/BETA2-mediated transcriptional activation. J Biol Chem277 :12998 eC13006,2002
Noguchi H, Kobayashi N, Westerman KA, Sakaguchi M, Okitsu T, Totsugawa T, Watanabe T, Matsumura T, Fujiwara T, Ueda T, Miyazaki M, Tanaka N, Leboulch P: Controlled expansion of human endothelial cell populations by Cre-loxP-based reversible immortalization. Hum Gene Ther13 :321 eC334,2002
Noguchi H, Kaneto H, Weir GC, Bonner-Weir S: PDX-1 protein containing its own antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes52 :1732 eC1737,2003
Noguchi H, Matsumoto S, Okitsu T, Iwanaga Y, Yonekawa Y, Nagata H, Matsushita M, Wei FY, Matsui H, Minami K, Seino S, Masui Y, Futaki S, Tanaka K: PDX-1 protein is internalized by lipid raft-dependent macropinocytosis. Cell Transplant. In press
Noguchi H, Matsushita M, Matsumoto S, Lu YF, Matsui H, Bonner-Weir S: Mechanism of PDX-1 protein transduction. Biochem Biophys Res Commun332 :68 eC74,2005
Conner SD, Schmid SL: Regulated portals of entry into the cell. Nature422 :37 eC44,2003
West MA, Bretscher MS, Watts C: Distinct endocytotic pathways in epidermal growth factor-stimulated human carcinoma A431 cells. J Cell Biol109 :2731 eC2739,1989
Sampath P, Pollard TD: Effects of cytochalasin, phalloidin, and pH on the elongation of actin filaments. Biochemistry30 :1973 eC1980,1991
Bowman EJ, Siebers A, Altendorf K: Bafilomycins: a class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc Natl Acad Sci U S A85 :7972 eC7976,1988
Drecktrah D, de Figueiredo P, Mason RM, Brown WJ: Retrograde trafficking of both Golgi complex and TGN markers to the ER induced by nordihydroguaiaretic acid and cyclofenil diphenol. J Cell Sci111 :951 eC965,1998
Noguchi H, Nakai Y, Matsumoto S, Kawaguchi M, Ueda M, Okitsu T, Iwanaga Y, Yonekawa Y, Nagata H, Minami K, Masui Y, Futaki S, Tanaka K: Cell permeable peptide of JNK inhibitor prevents islet apoptosis immediately after isolation and improves islet graft function. Am J Transplant5 :1848 eC1855,2005
Mi Z, Mai J, Lu X, Robbins PD: Characterization of a class of cationic peptides able to facilitate efficient protein transduction in vitro and in vivo. Mol Ther2 :339 eC347,2000
Glick E, Leshkowitz D, Walker MD: Transcription factor BETA2 acts cooperatively with E2A and PDX1 to activate the insulin gene promoter. J Biol Chem275 :2199 eC2204,2000
Ohneda K, Mirmira RG, Wang J, Johnson JD, German MS: The homeodomain of PDX-1 mediates multiple protein-protein interactions in the formation of a transcriptional activation complex on the insulin promoter. Mol Cell Biol20 :900 eC911,2000
Jonsson J, Carlsson L, Edlund T, Edlund H: Insulin-promoter-factor 1 is required for pancreas development in mice. Nature371 :606 eC609,1994
Miyachi T, Maruyama H, Kitamura T, Nakamura S, Kawakami H: Structure and regulation of the human NeuroD (BETA2/BHF1) gene. Brain Res Mol Brain Res69 :223 eC231,1999
Marshak S, Benshushan E, Shoshkes M, Havin L, Cerasi E, Melloul D: Functional conservation of regulatory elements in the pdx-1 gene: PDX-1 and hepatocyte nuclear factor 3 transcription factors mediate -celleCspecific expression. Mol Cell Biol20 :7583 eC7590,2000(Hirofumi Noguchi,, Susan )
2 Section on Islet Transplantation and Cell Biology, Joslin Diabetes Center, Harvard Medical School, Boston, Massachusetts
3 Department of Physiology, Okayama University Graduate School of Medicine and Dentistry, Okayama, Japan
4 Transplantation Unit, Kyoto University Hospital, Kyoto, Japan
ABSTRACT
BETA2/NeuroD, a basic helix-loop-helix transcription factor, is a key regulator of pancreatic islet morphogenesis and insulin gene transcription. Here we report for the first time that the BETA2/NeuroD protein can permeate several cells, including pancreatic islets, due to an arginine- and lysine-rich protein transduction domain sequence in its structure. The BETA2/NeuroD protein was transduced in a dose-dependent manner up to 1 e蘭ol/l. Transduced BETA2/NeuroD functions similarly to endogenous BETA2/NeuroD: it binds to the insulin promoter and activates its expression. We also investigated the mechanism of BETA2/NeuroD protein transduction. The BETA2/NeuroD protein penetrated cells by macropinocytosis and was released from endosomes homogeneously in cytoplasm and nuclei. These data suggest that BETA2/NeuroD protein transduction could be a safe and valuable strategy for enhancing insulin gene transcription without requiring gene transfer technology.
Basic helix-loop-helix (bHLH) proteins are transcription factors involved in the specification of cell type and differentiation during development (1eC3). The BETA2/NeuroD protein, a class B bHLH factor, has been cloned as both a transcriptional activator of the insulin gene (4) and a neurogenic factor in Xenopus embryos (2). BETA2/NeuroD is expressed transiently in a subset of neurons in the central and peripheral nervous systems at the time of their terminal differentiation (2). Moreover, this protein is important for regulating insulin gene transcription (4) and for the terminal differentiation of islet cells, including insulin- and glucagon-producing cells. In BETA2/NeuroD gene-targeting experiments, mutant mice developed severe diabetes with ketoacidosis and died perinatally (5).
Since the discovery of protein transduction domains (PTDs), which allow proteins to be translocated across the plasma membrane and into nuclei, there has been increasing interest in their potential to deliver bioactive peptides and proteins into eukaryotic cells as a valuable strategy for the transduction of therapeutic proteins into patients. The small PTDs from the TAT protein of HIV-1 (6,7), the VP22 protein of Herpes simplex virus (8), and the Antennapedia homeoprotein of Drosophila (9) have been fused to proteins, resulting in the remarkable delivery of proteins into many mammalian tissues.
Recently, we and others have shown that the important sequences in protein transduction are arginine and lysine (10eC12). We have noticed that the transcription factor BETA2/NeuroD protein has an arginine- and lysine-rich sequence that is conserved across species (mice, rats, and humans) (Fig. 1A). The presence of a PTD in BETA2/NeuroD is intriguing, given that BETA2/NeuroD plays such an important role in islet cell differentiation and survival, islet morphogenesis, and the maintenance of normal -cell function due to its regulation of insulin genes (4). Clinically, mutations in BETA2/NeuroD result in both type 1 and 2 diabetes, including maturity-onset diabetes of the young (13eC16). BETA2/NeuroD expression and its DNA binding activity are reduced in association with decreased insulin gene expression in several diabetic models (17,18).
Here we report for the first time that the BETA2/NeuroD protein can permeate cells due to an arginine- and lysine-rich sequence in its structure and that transduced BETA2/NeuroD functions similarly to endogenous BETA2/NeuroD.
RESEARCH DESIGN AND METHODS
Construction of BETA2/NeuroD protein vectors and purification of recombinant BETA2/NeuroD proteins.
Full-length BETA2/NeuroD cDNA was amplified by PCR using appropriate linker-primers and then subcloned into the Nde I and Xho I sites of pET21b(+) (Novagen, Madison, WI) using a ligation kit (TaKaRa, Tokyo, Japan). On mutant plasmids, sequences before and after each deletion were amplified by PCR using appropriate linker-primers and were then subcloned into the Nde IeCHindIII and HindIIIeCXho I sites of pET21b(+), respectively. BL21 (DE3) cells containing the expression plasmids were grown at 37°C to an optical density 600 of 0.8. Isopropyl--D-thiogalactopyranoside was added to a final concentration of 0.1 mmol/l, and the cells were then incubated for 12 h at 24°C. Cells were sonicated and the supernatants were recovered and applied to a column of Ni-nitrilotriacetic acid agarose (Invitrogen, San Diego, CA). Purified BETA2/NeuroD proteins were conjugated using a Cy5-labeling kit (Amersham Pharmacia, Piscataway, NJ).
Isolation and culture of rat pancreatic islets.
Islets were isolated from the pancreases of anesthetized male SD rats (200eC250 g; Taconic Farms, Germantown, NY). All animal procedures were approved by the review committee of Kyoto University Graduate School of Medicine. The common bile duct was cannulated and injected with 6 ml cold M199 medium containing 1.5 mg/ml collagenase (Roche Boehringer Mannheim, Indianapolis, IN). The islets were separated on Histopaque 1077 (Sigma, St. Louis, MO) density gradient, hand picked under a dissecting microscope to ensure a pure islet preparation, and used immediately afterward. In these experiments, islets were cultured in RPMI medium with 10% FCS.
Western blotting.
Western blotting was conducted in accordance with the method described previously (19). In brief, after being washed three times with PBS and high salt buffer, cells were scraped from the dish and sonicated. Then 10 e蘥 of cell extracts were fractionated by 10% SDS-PAGE and transferred to polyvinylidine fluoride membranes (Immun-Blot PVDF Membrane; Bio-RAD, Hercules, CA) using a transfer buffer containing 20% methanol, 25 mmol/l Tris base, and 192 mmol/l glycine (300 mA, 2 h). After being blocked at room temperature for 1 h in 50 mmol/l Tris-HCl, 150 mmol/l NaCl, and 0.1% Tween-20 (TBST) with 5% nonfat dry milk, the membranes were incubated overnight at 4°C in TBST using 5% nonfat dry milk containing goat antieCBETA2/NeuroD antibody (Santa Cruz Biotechnology, Santa Cruz, CA), mouse anti-actin antibody (1:1,000; Sigma), or horseradish peroxidaseeCconjugated antieC6 histidine antibody (1:5,000; Invitrogen). For antieCBETA2/NeuroD antibody or anti-actin antibody, the membranes were then incubated for 1 h at room temperature in TBST with 5% nonfat dry milk containing anti-goat or anti-mouse IgG antibody coupled to horseradish peroxidase (1:1,000; Bio-Rad).
Gel-mobility shift assay.
For this assay, 2 e蘥 nuclear extract were incubated with 2 e蘥 poly (dI-dC), 25 mmol/l HEPES (pH 7.8), 0.2 mmol/l EDTA, 150 mmol/l KCl, 5 mmol/l dithiothreitol, and 9% glycerol at room temperature. The binding reaction was initiated by adding 32P-labeled double-stranded oligonucleotide probes. A double-stranded oligonucleotide reproducing the rat insulin gene BETA2/NeuroDeCbinding region (E-box) and surrounding sequences (ACGTTCTGGCCATCTGCTGAT CCTACGT; E-box in italics) or E-boxeCmutated sequences (ACGTTCTGGCTTTCCCCTGAT CCTACGT) (Sigma Genosys, Woodlands, TX) was used as a binding probe. In some binding assays, antieCBETA2/NeuroD, antieC6 histidine antibody, and preimmune antisera were added to the reaction mixture 1 h before DNA probes were added.
Gene transfection and luciferase assay.
A rat insulin II promoter-reporter (luciferase) plasmid (1.0 e蘥) containing 238-bp 5'-flanking sequences of the rat insulin II promoter region (20) or E-boxeCmutated insulin II promoter-reporter plasmid (1.0 e蘥) (18) was transfected into cells with LipofectAMINE (Invitrogen) using the conditions recommended by the manufacturer. Then 48 h after the transfection, the cells were harvested and assayed (Promega, Madison, WI).
Fluorescein isothiocyanateeCconjugated BETA2/NeuroD PTD.
Fluorescein isothiocyanate (FITC)eCconjugated BETA2/NeuroD PTD peptide was synthesized by Sigma Genosys-Japan. The peptide was purified by preparative reversed-phase high-performance liquid chromatography, was confirmed as >95% pure as analyzed by high-performance liquid chromatography, and had the expected amino acid composition and mass spectra.
Treatment with FITCeCBETA2/NeuroD PTD and FM4eC64.
Cervix-derived HeLa cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% FCS and penicillin-streptomycin. Cells were treated with 1 e蘭ol/l BETA2/NeuroD PTD for the specified time and then washed with fresh medium. To evaluate endocytosis, cells were incubated with 1 e蘭ol/l FITCeCBETA2/NeuroD PTD and 10 e蘭ol/l FM 4eC64 (Molecular Probes, Eugene, OR), a marker of endocytosis. Treated living cells were analyzed by conventional fluorescence microscopy and confocal microscopy.
Treatment with a plasmid expressing a dominant-negative mutant of dynamin.
HeLa cells were transfected with a plasmid expressing a dominant-negative mutant of dynamin-1 (DynDN), Discosoma sp. red fluorescent protein (DsRed), as previously described (21). After 24 h, cells were washed and treated with 1 e蘭ol/l FITCeCBETA2/NeuroD PTD in complete medium. After cells were incubated overnight, the FITC and DsRed signals were examined.
Treatment with amiloride and cytochalasin D.
To measure the mechanism of BETA2/NeuroD internalization, HeLa cells were plated and cultured in Dulbecco’s modified Eagle’s medium with 10% FBS. Cells were then pretreated for 10 or 30 min in serum-free medium with 5 mmol/l amiloride (Sigma) or 10 e蘭ol/l cytochalasin D (Sigma), respectively. After the BETA2/NeuroD PTD was added, cells were maintained for 1 h in the presence of inhibitors, washed several times, and incubated for 1 h in complete medium.
RESULTS
Transduction of the BETA2/NeuroD protein into cells.
To test whether the purified BETA2/NeuroD protein can be transduced into cells, cervix-derived HeLa, liver-derived HepG2, -celleCderived HIT-T15 cells, and primary rat islets and duct cells were treated with Cy5-conjugated BETA2/NeuroD protein. Then 6 h after this treatment, BETA2/NeuroD was observed as a fluorescence signal in primary islets, duct cells, HIT-T15, HepG2 (Fig. 1B), and HeLa cell lines (Fig. 2C1). Although it has previously been shown that some homeoprotein transcription factors can enter a large number of cell types (9,20eC22), our results showed that the BETA2/NeuroD protein, a bHLH transcription factor, is delivered into cells without requiring any additional sequences.
Protein transduction domain of BETA2/NeuroD protein.
To clarify the location of the PTD of BETA2/NeuroD, we made several Cy5-conjugated deletion proteins (Fig. 2A and B). Full-length BETA2/NeuroD protein and deletion BETA2/NeuroD (dNeuroD)-2, -4, -7, -8, and -9, but not the other dNeuroDs, could be transduced into HeLa cells (Fig. 2C and D). Both dNeuroD-8 and -9 proteins could be transduced into cells, but the Cy5 signals were weaker than that with full-length protein treatment (Fig. 2C). These data show that the 34 amino acids of the putative BETA2/NeuroD PTD are necessary for the BETA2/NeuroD protein to be efficiently transduced into cells (Fig. 3A). As we and others have recently shown, the sequences of BETA2/NeuroD protein are rich in arginine and lysine (10eC12).
Transduction efficiency of the BETA2/NeuroD PTD.
To test the transduction efficiency of the PTD of BETA2/NeuroD, we made enhanced green fluorescent protein (EGFP)eCfused PTDs. EGFP with 11 arginine (11R) PTD, the most effective protein transduction domain (10,11), and EGFP without PTD were used as positive and negative controls, respectively (Figs. 3A and B). HeLa cells were treated with these EGFP proteins for 6 h and analyzed by Western blotting (Fig. 3C) and confocal microscopy (Fig. 3D). The transduction efficiency of the full-length BETA2/NeuroD PTD was similar to that of the 11R PTD, whereas the efficiency of the partial sequence of the PTD was about half that of the 11R PTD (Figs. 3C and D). These data show that the transduction efficiency of BETA2/NeuroD PTD is as strong as that of 11R PTD.
Dose-dependent transduction of BETA2/NeuroD and the stability of transduced BETA2/NeuroD protein.
To test the effectiveness of transduced BETA2/NeuroD, HeLa cells were treated with the BETA2/NeuroD protein at several concentrations for 2 h, washed with PBS, incubated with conventional medium, and analyzed by Western blotting (Fig. 4A). The BETA2/NeuroD protein was transduced in a dose-dependent manner up to 1 e蘭ol/l. To determine the stability of the BETA2/NeuroD protein, HeLa cells were treated with 1 e蘭ol/l BETA2/NeuroD for 2 h, washed with PBS, incubated with conventional medium for 1eC46 h, and analyzed by Western blotting. The half-life of BETA2/NeuroD was 5 h (Fig. 4B). In addition, the transduced BETA2/NeuroD could be detected using an antibody to the histidine tag included in this synthesized protein.
Effects of transduced BETA2/NeuroD on clonal cells.
The insulin-enhancer element E-box is the binding site for BETA2/NeuroD and plays an important role in the regulation of insulin gene transcription (4,17,18). We therefore used a gel shift assay to test whether the transduced BETA2/NeuroD protein binds to the insulin-enhancer element. HeLa cells were treated with 1 e蘭ol/l BETA2/NeuroD protein, dNeuroD-6 (PTD-deleted BETA2/NeuroD protein), and EGFP with BETA2/NeuroD PTD (EGFP-PTD) for 24 h. The nuclear extract of HIT-T15 cells was used as a positive control. The E-box binding complex, but not the mutated E-box, was observed in nuclear extracts from treated HeLa cells. The specificity of the band was confirmed by its supershift with BETA2/NeuroD antibody and antieC6 histidine antibody but not by preimmune serum (Fig. 5A).
To test whether transduced BETA2/NeuroD protein can activate insulin gene transcription, we examined its effect on insulin promoter activity using a luciferase assay. HeLa cells were transfected with an insulin promotereCluciferase plasmid and allowed to grow for 24 h; they were then treated with 1 e蘭ol/l BETA2/NeuroD protein, dNeuroD-6, and EGFP-PTD for an additional 24 h, after which a luciferase assay was performed. Insulin promoter activity was increased by treatment with BETA2/NeuroD protein in HeLa cells (Fig. 5B) but not by treatment with dNeuroD-6 or EGFP-PTD. Mutated insulin promoter activity was not significantly changed by any treatment. Taken together, these results suggest that exogenous BETA2/NeuroD protein can be transduced into cells and their nuclei, bind to the E-box, and activate the insulin promoter.
Transduction of BETA2/NeuroD protein by endocytosis.
To investigate the mechanism of BETA2/NeuroD protein transduction, HeLa cells were treated with FITC-conjugated BETA2/NeuroD PTD and FM 4eC64, a marker of endocytosis, for 30 min and then washed with fresh media. The PTD fluorescence signal appeared as punctate within living, unfixed HeLa cells. This punctate PTD mainly co-localized with FM 4eC64 in living cells (Fig. 6A). After an additional 90 min, the PTD was homogeneously distributed in the cytosol and nuclei of some cells, whereas the FM dye remained in the endosome (Fig. 6A). These data show that the cellular uptake of BETA2/NeuroD PTD occurs through electrostatic interaction with the plasma membrane, subsequent endocytosis, and escape from the endosome with eventual homogeneous distribution in the cytoplasm.
BETA2/NeuroD protein transduction is independent of phagocytosis or clathrin- or caveolar-mediated endocytosis.
It was then determined whether the cellular uptake of BETA2/NeuroD occurs through a specific endocytic pathway. Multiple forms of endocytosis, including phagocytosis and clathrin- and caveolar-mediated endocytosis, require dynamin GTPase activity for vesicle formation at the cell surface. The expression of DynDN effectively blocks these endocytic pathways (21,23). We transfected cells with the DynDN-DsRed plasmid, treated the cells with FITC-conjugated BETA2/NeuroD PTD 24 h after transfection, and analyzed FITC signals at 48 h. The expression of DynDN did not block BETA2/NeuroD PTD uptake and recombination (Fig. 6B). These observations show that the BETA2/NeuroD internalization process does not involve caveolar- or clathrin-mediated endocytosis.
BETA2/NeuroD protein enters cells by lipid raft macropinocytosis.
Recently, it was reported that PTD-mediated cellular entry occurs by macropinocytosis (7,21). Macropinocytosis is a rapid, lipid rafteCdependent, and receptor-independent form of endocytosis. It requires actin membrane protrusions that envelope vesicles, termed macropinosomes (23). To examine the involvement of macropinocytosis in transduction, cells were pretreated with amiloride, a specific inhibitor of the Na+/H+ exchange required for macropinocytosis (24), or cytochalasin D, an F-actin elongation inhibitor (25). Pretreated cells were then incubated with BETA2/NeuroD PTD for 1 h and washed with complete medium. Cell treatment with either macropinosome inhibitor resulted in the reduction of BETA2/NeuroD PTD transduction into vesicles with no cytotoxicity (Fig. 7A). Taken together, these observations showing rapid transduction into cells, dynamin-1 independence, and uptake inhibition by amiloride and cytochalasin D, indicate that BETA2/NeuroD PTDeCmediated cellular entry occurs by lipid rafteCmediated macropinocytosis.
Impact of bafilomycin A1 or brefeldin A on the cellular distribution of BETA2/NeuroD PTD.
Bafilomycin A1 is a highly potent and selective inhibitor of vacuolar H+ ATPases and inhibits endosomal acidification (26). The effect of bafilomycin A1 on the intracellular localization of the peptide was tested: 30 min before the PTD peptide was added, cells were washed once and then 300 nmol/l bafilomycin was added to the medium. After a 2-h incubation with BETA2/NeuroD PTD, no cytoplasmic fluorescence was present and only vesicular staining was observed (Fig. 7B). These data show that the release of PTD into the cytosol occurs by a mechanism dependent on endosomal acidification and preserved endosomal integrity.
We next addressed the potential involvement of the Golgi complex in the cellular trafficking of BETA2/NeuroD PTD. Brefeldin A interferes with the integrity of the Golgi and trans-Golgi network and affects the uptake of the TAT fusion protein (27). In this study, cells were washed once and 20 e蘭ol/l brefeldin A was added 30 min before the peptide was introduced. After a 2-h incubation with the peptide, the cellular fluorescence of BETA2/NeuroD PTD was reduced (Fig. 7B), similar to what was seen with bafilomycin A1. Taken together, these data suggest that the BETA2/NeuroD protein penetrated cells by macropinocytosis and entered the cytoplasm by means of retrograde transport (Fig. 8).
DISCUSSION
PTDs are a series of small domains that have been shown to cross biological membranes efficiently, independently of transporters or specific receptors, and promote the delivery of full-length proteins in a rapid and concentration-dependent fashion into a large number of cells. These PTDs are arginine- and lysine-rich sequences, especially the TAT PTD. We and others have shown that proteins with fused polyarginine or polylysine sequences can permeate several cell types even more efficiently (10eC12,28). It has also been shown that >40% of lysine- and arginine-rich peptides within 11eC16 amino acids can permeate cells (29). BETA2/NeuroD has arginine- and lysine-rich sequences in its own sequence and the arginine and lysine content is 53% over 34 amino acids.
BETA2/NeuroD is selectively expressed in the developing endocrine pancreas, the small intestine, and the nervous system (2) and plays an important role in maintaining the differentiation of endocrine cells, proper islet morphogenesis, and normal cell function, especially -cell function, by regulating the insulin gene (4,5). Mice with an inactivated BETA2/NeuroD gene die of severe diabetes caused by a major reduction in the number of -cells and a lack of proper islet formation (4). BETA2/NeuroD strongly stimulates DNA-binding capacity by heterodimerization with class A bHLH proteins, such as the ubiquitous E47. The PTD of BETA2/NeuroD includes the DNA-binding region of the bHLH factor. Thus the 34 amino acids of BETA2/NeuroD PTD are extremely important in several other aspects of its function.
Because the DNA-binding domain is conserved between different bHLH proteins (Fig. 8B, underlined), most, but not all, bHLH proteins could be transduced into cells. However, transduction efficiency is extremely different between each bHLH protein because sequences before the DNA binding domain are quite different. Neurogenin 3 and myogenic determination factor could be transduced into cells, but the efficiency is less than that of the BETA2/NeuroD protein (H.N., M.M., unpublished observations). E47 is hardly transduced into cells.
Our study showed that BETA2/NeuroD protein has a native PTD and, without modification, can permeate several cell types and enhance insulin promoter activity in these cells. In the insulin promoter, E-boxes, corresponding to the consensus CANNTG, are the binding site of heterodimer E47/BETA2 and are juxtaposed to AT-rich elements (A-box) that bind pancreatic duodenal homeobox 1 (PDX-1). The synergistic activation of cis-elements is observed between BETA2 and PDX-1 (30,31). Moreover, these two proteins are important in pancreatic development (5,32). We have reported that the PDX-1 protein can transduce cells because of its own Antennapedia-like protein and that PDX-1 protein induces insulin expression in pancreatic ductal cells, thought to be islet progenitor cells (20). The exogenous BETA2/NeuroD protein also induces insulin expression in pancreatic ductal progenitor cells (H.N., S.M., unpublished observations). The BETA2/NeuroD gene has E-boxes, and the BETA2/NeuroD protein could stimulate its own transcription (33). Furthermore, the pdx-1 gene has A-boxes, and the PDX-1 protein could positively autoregulate its expression (34). Once the BETA2/NeuroD and PDX-1 proteins are transduced into progenitor cells, endogenous BETA2/NeuroD and pdx-1 gene transcription are amplified by these proteins, stimulate insulin transcription, and may facilitate their differentiation into insulin-producing cells. Our finding of a functional PTD in transcription factor BETA2/NeuroD suggests that exogenous BETA2/NeuroD could be a novel approach for generating surrogate -cells without requiring gene transfer technology.
ACKNOWLEDGMENTS
H.N. is a Research Fellow of the Japan Society for the Promotion of Science, Kyoto University Graduate School of Medicine.
We thank Dr. Susumu Seino (Kobe University) and Kotaro Minami (Kyoto University) for materials.
bHLH, basic helix-loop-helix; dNeuroD, deletion BETA2/NeuroD; dNeuroD-6, PTD-deleted BETA2/NeuroD protein; DsRed, Discosoma sp. red fluorescent protein; DynDN, dominant-negative mutant of dynamin-1; EGFP, enhanced green fluorescent protein; EGFP-PTD, EGFP with BETA2/NeuroD PTD; FITC, fluorescein isothiocyanate; PDX-1, pancreatic duodenal homeobox 1; PTD, protein transduction domain; TBST, Tris-buffered saline with Tween
REFERENCES
Bang AG, Goulding MD: Regulation of vertebrate neural cell fate by transcription factors. Curr Opin Neurobiol6 :25 eC32,1996
Lee JE, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H: Conversion of Xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science268 :836 eC844,1995
Olson EN, Klein WH: bHLH factors in muscle development: dead lines and commitments, what to leave in and what to leave out. Genes Dev8 :1 eC8,1994
Naya FJ, Stellrecht CM, Tsai MJ: Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev9 :1009 eC1019,1995
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev11 :2323 eC2334,1997
Schwarze SR, Ho A, Vocero-Akbani A, Dowdy SF: In vivo protein transduction: delivery of a biologically active protein into the mouse. Science285 :1569 eC1572,1999
Wadia JS, Stan RV, Dowdy SF: Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nat Med10 :310 eC315,2004
Elliott G, O’Hare P: Intercellular trafficking and protein delivery by a herpes virus structural protein. Cell88 :223 eC233,1997
Joliot A, Prochiantz A: Transduction peptides: from technology to physiology. Nat Cell Biol6 :189 eC196,2004
Matsushita M, Tomizawa K, Moriwaki A, Li ST, Terada H, Matsui H: A high-efficiency protein transduction system demonstrating the role of PKA in long-lasting long-term potentiation. J Neurosci21 :6000 eC6007,2001
Matsui H, Tomizawa K, Lu YF, Matsushita M: Protein therapy: in vivo protein transduction by polyarginine (11R) PTD and subcellular targeting delivery. Curr Protein Pept Sci4 :151 eC157,2003
Noguchi H, Matsushita M, Okitsu T, Moriwaki A, Tomizawa K, Kang S, Li ST, Kobayashi N, Matsumoto S, Tanaka K, Tanaka N, Matsui H: A new cell-permeable peptide allows successful allogeneic islet transplantation in mice. Nat Med10 :305 eC309,2004
Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet23 :323 eC328,1999
Kristinsson SY, Thorolfsdottir ET, Talseth B, Steingrimsson E, Thorsson AV, Helgason T, Hreidarsson AB, Arngrimsson R: MODY in Iceland is associated with mutations in HNF-1alpha and a novel mutation in NeuroD1. Diabetologia44 :2098 eC2103,2001
Iwata I, Nagafuchi S, Nakashima H, Kondo S, Koga T, Yokogawa Y, Akashi T, Shibuya T, Umeno Y, Okeda T, Shibata S, Kono S, Yasunami M, Ohkubo H, Niho Y: Association of polymorphism in the NeuroD/BETA2 gene with type 1 diabetes in the Japanese. Diabetes48 :416 eC419,1999
Hansen L, Jensen JN, Urioste S, Petersen HV, Pociot F, Eiberg H, Kristiansen OP, Hansen T, Serup P, Nerup J, Pedersen O: NeuroD/BETA2 gene variability and diabetes: no associations to late-onset type 2 diabetes but an A45 allele may represent a susceptibility marker for type 1 diabetes among Danes: Danish Study Group of Diabetes in Childhood and the Danish IDDM Epidemiology and Genetics Group. Diabetes49 :876 eC878,2000
Jonas JC, Sharma A, Hasenkamp W, Ilkova H, Patane G, Laybutt R, Bonner-Weir S, Weir GC: Chronic hyperglycemia triggers loss of pancreatic beta cell differentiation in an animal model of diabetes. J Biol Chem274 :14112 eC14121,1999
Kaneto H, Sharma A, Suzuma K, Laybutt DR, Xu G, Bonner-Weir S, Weir GC: Induction of c-Myc expression suppresses insulin gene transcription by inhibiting NeuroD/BETA2-mediated transcriptional activation. J Biol Chem277 :12998 eC13006,2002
Noguchi H, Kobayashi N, Westerman KA, Sakaguchi M, Okitsu T, Totsugawa T, Watanabe T, Matsumura T, Fujiwara T, Ueda T, Miyazaki M, Tanaka N, Leboulch P: Controlled expansion of human endothelial cell populations by Cre-loxP-based reversible immortalization. Hum Gene Ther13 :321 eC334,2002
Noguchi H, Kaneto H, Weir GC, Bonner-Weir S: PDX-1 protein containing its own antennapedia-like protein transduction domain can transduce pancreatic duct and islet cells. Diabetes52 :1732 eC1737,2003
Noguchi H, Matsumoto S, Okitsu T, Iwanaga Y, Yonekawa Y, Nagata H, Matsushita M, Wei FY, Matsui H, Minami K, Seino S, Masui Y, Futaki S, Tanaka K: PDX-1 protein is internalized by lipid raft-dependent macropinocytosis. Cell Transplant. In press
Noguchi H, Matsushita M, Matsumoto S, Lu YF, Matsui H, Bonner-Weir S: Mechanism of PDX-1 protein transduction. Biochem Biophys Res Commun332 :68 eC74,2005
Conner SD, Schmid SL: Regulated portals of entry into the cell. Nature422 :37 eC44,2003
West MA, Bretscher MS, Watts C: Distinct endocytotic pathways in epidermal growth factor-stimulated human carcinoma A431 cells. J Cell Biol109 :2731 eC2739,1989
Sampath P, Pollard TD: Effects of cytochalasin, phalloidin, and pH on the elongation of actin filaments. Biochemistry30 :1973 eC1980,1991
Bowman EJ, Siebers A, Altendorf K: Bafilomycins: a class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc Natl Acad Sci U S A85 :7972 eC7976,1988
Drecktrah D, de Figueiredo P, Mason RM, Brown WJ: Retrograde trafficking of both Golgi complex and TGN markers to the ER induced by nordihydroguaiaretic acid and cyclofenil diphenol. J Cell Sci111 :951 eC965,1998
Noguchi H, Nakai Y, Matsumoto S, Kawaguchi M, Ueda M, Okitsu T, Iwanaga Y, Yonekawa Y, Nagata H, Minami K, Masui Y, Futaki S, Tanaka K: Cell permeable peptide of JNK inhibitor prevents islet apoptosis immediately after isolation and improves islet graft function. Am J Transplant5 :1848 eC1855,2005
Mi Z, Mai J, Lu X, Robbins PD: Characterization of a class of cationic peptides able to facilitate efficient protein transduction in vitro and in vivo. Mol Ther2 :339 eC347,2000
Glick E, Leshkowitz D, Walker MD: Transcription factor BETA2 acts cooperatively with E2A and PDX1 to activate the insulin gene promoter. J Biol Chem275 :2199 eC2204,2000
Ohneda K, Mirmira RG, Wang J, Johnson JD, German MS: The homeodomain of PDX-1 mediates multiple protein-protein interactions in the formation of a transcriptional activation complex on the insulin promoter. Mol Cell Biol20 :900 eC911,2000
Jonsson J, Carlsson L, Edlund T, Edlund H: Insulin-promoter-factor 1 is required for pancreas development in mice. Nature371 :606 eC609,1994
Miyachi T, Maruyama H, Kitamura T, Nakamura S, Kawakami H: Structure and regulation of the human NeuroD (BETA2/BHF1) gene. Brain Res Mol Brain Res69 :223 eC231,1999
Marshak S, Benshushan E, Shoshkes M, Havin L, Cerasi E, Melloul D: Functional conservation of regulatory elements in the pdx-1 gene: PDX-1 and hepatocyte nuclear factor 3 transcription factors mediate -celleCspecific expression. Mol Cell Biol20 :7583 eC7590,2000(Hirofumi Noguchi,, Susan )