An Activator of the Glucagon Gene Expressed in Developing Islet - and -Cells
http://www.100md.com
糖尿病学杂志 2006年第2期
1 Department of Molecular Physiology and Biophysics, Vanderbilt University Medical Center, Nashville, Tennessee
2 Department of Genetics, St. Jude Children’s Research Hospital, Memphis, Tennessee
3 Sarah W. Stedman Nutrition and Metabolism Center, Duke University Medical Center, Durham, North Carolina
Key Words: CMV, cytomegalovirus MOI, multiplicity of infection PEPCK, phosphoenolpyruvate carboxykinase
ABSTRACT
The large Maf family of basic leucine-zippereCcontaining transcription factors are known regulators of key developmental and functional processes in various cell types, including pancreatic islets. Here, we demonstrate that within the adult pancreas, MafB is only expressed in islet -cells and contributes to cell typeeCspecific expression of the glucagon gene through activation of a conserved control element found between nucleotides eC77 to eC51. MafB was also shown to be expressed in developing - and -cells as well as in proliferating hormone-negative cells during pancreatogenesis. In addition, MafB expression is maintained in the insulin+ and glucagon+ cells remaining in mice lacking either the Pax4 or Pax6 developmental regulators, implicating a potentially early role for MafB in gene regulation during islet cell development. These results indicate that MafB is not only important to islet -cell function but may also be involved in regulating genes required in both endocrine - and -cell differentiation.
The pancreatic islets of Langerhans are composed of -, -, -, and pancreatic polypeptide cells, which independently produce the hormones glucagon, insulin, somatostatin, and pancreatic polypeptide, respectively. Collectively, these hormones regulate both fuel and energy metabolism, with insulin and glucagon key to controlling glucose homeostasis (1). Thus, glucagon secreted from -cells stimulates the mobilization of glucose through gluconeogenesis and glycogenolysis to prevent hypoglycemia, whereas -celleCsecreted insulin promotes glucose storage. Physiological glucose levels are maintained through the counter-regulatory actions of glucagon and insulin in peripheral tissues, with defects in - and -cell function playing a significant part in the ability of diabetic patients to maintain glycemic control.
The identification and characterization of the transcription factors regulating insulin and glucagon expression have not only revealed their significance in islet function but also during pancreatogenesis. The pancreas develops from dorsal and ventral epithelial bud evaginations from the foregut, with glucagon-producing cells first appearing at mouse embryonic day (E) 9.5 in the dorsal bud (2eC4). Insulin-producing cells emerge at E10.5 (3), whereas somatostatin and pancreatic polypeptide+ cells are not detected until E15.5 and E18.5, respectively (5). Insulin- and glucagon-producing cells appear in waves during development, with the functional - and -cells that will populate the islet produced starting at E13.5 (5). This latter phase is termed the "secondary transition," and these cells continue to proliferate but are only organized into islet structures and become glucose-responsive shortly after birth (6).
The transcription factors associated with controlling cell-specific expression of the insulin and glucagon genes are principal regulators of islet cell formation, including Pdx1 (7eC10), Pax6 (11,12), Pax4 (13,14), and NeuroD1 (15,16). Pdx1 is necessary for the growth of the endocrine and exocrine compartments, with pancreatic agenesis observed in pdx1 mutant mice (17,18). In contrast, the loss of pax6 (12,19,20), pax4 (21,22), and neuroD1 (23) only affects islet cell development. Heterozygous mutations in Pdx1 (24), Pax6 (25), and NeuroD1 (26) also contribute to the formation of diabetes in humans, establishing a key conserved role for these factors in islet cell activity.
MafA is another essential activator of the insulin gene (27eC31). Specific roles for MafA in processes important to islet cell formation and function have been suggested upon observing that MafA is first produced in insulin-producing cells of the secondary transition and was also capable of independently inducing insulin expression in noneC-cells (27,32). Its significance to -cell function has recently been confirmed in MafA-deficient mice, which are glucose intolerant and develop diabetes (33). Interestingly, no developmental islet cell phenotype was reported in MafAeC/eC animals, a surprise considering its embryonic expression pattern and that all other closely related members of the large Maf transcription factor family are associated with processes necessary for cell formation, including the brain (i.e., MafB [34,35]), cartilage (c-Maf [36]), and immune system (c-Maf [37]).
In addition to MafA, MafB is capable of activating insulin enhancereCdriven expression in noneCislet cell transfection assays, even though MafB is primarily found in islet -cells (28). The members of the large Maf transcription factor family all share a highly conserved NH2-terminal activation domain and a COOH-terminal basic leucine-zipper DNA-binding domain. Here, we show that MafB is an important regulator of glucagon gene expression. Thus, MafB was found to bind to and activate at conserved nucleotides eC77 to eC51 of the -celleCspecific promoter control element (termed G1). MafB was also capable of specifically activating endogenous glucagon expression when overexpressed in a -cell line. Furthermore, MafB was present in both insulin- and glucagon-producing cells during development, with expression only restricted to -cells soon after birth. Our data imply that MafB may be involved in regulating genes integral to islet - and -cell formation, with a long-term role in glucagon transcription in islets.
RESEARCH DESIGN AND METHODS
Immunohistochemistry.
Adult tissue and staged embryos were obtained from wild-type (Balb/c), Pax4eC/eC (22), and Pax6 seyNEU/seyNEU (38) mice (sey/sey). The day of vaginal-plug discovery was designated stage E0.5. Immunofluorescence and confocal image analyses were performed on paraffin sections as described previously (28). The primary antibodies used were rabbit anti-MafB (1:5,000; Bethyl Laboratories BL658, Montgomery, TX), goat anti-Pdx1 (1:10,000), mouse anti-ki67 (1:500; BD Biosciences, San Jose, CA), guinea pig anti-Ngn3 (1:1,000), guinea pig anti-insulin (1:2,000; Linco Research, St. Charles, MO), guinea pig anti-glucagon (1:2,000; Linco Research), guinea pig antieCpancreatic polypeptide (1:2,000; Linco Research), and sheep anti-somatostatin (1:2,000; American Research Products, Belmont, MA). Secondary antibodies were Cy3- or Cy5-conjugated donkey antieCguinea pig, anti-sheep, anti-goat, and anti-rabbit IgG (1:500; Jackson ImmunoResearch, West Grove, PA). Fluorescent images were captured with a Zeiss LSM 510 confocal microscope using an optical depth of 1 e蘭. Nuclear counterstaining was performed using YoPro1 (Molecular Probes, Eugene, OR).
DNA constructs and transfection assays.
The glucagon eC476 luciferase reporter (eC476 GLU) contains rat glucagon gene sequences from nucleotides eC476 to +10. The glucagon G1 mutant was generated in eC476 GLU using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA) with the rat G1 MUTeC73ATTTATATTGTCGTAATATCTGCAeC47 oligonucleotide; the mutated sequence is underlined. The construction of the cytomegalovirus (CMV)-driven MafB expression construct (CMV:MafB) in pcDNA3.1 has been described previously (28). An expression construct encoding amino acids 210eC323 of MafB (CMV:MafB [210eC323]) was prepared by PCR amplification (top primer, 5'-ATGCGCTTCTCTGATGACCAGCTGG-3'; bottom primer, 5'-TCACAGAAAGAACTCAGGAGAGG-3') and subcloned into pcDNA3.1 (Invitrogen). All mutated constructs were verified by sequencing.
Monolayer cultures of HeLa and TC-6 were maintained as described previously (28,32). Transfections were performed using the lipofectamine reagent (Invitrogen) under the manufacturer’s conditions. Extracts from cells were prepared 40 to 48 h after transfection and analyzed for glucagon-driven firefly luciferase and thymidine kinaseeCdriven renilla luciferase (i.e., using phRL-TK; Promega, Madison, WI) activity using the Dual-Luciferase Reporter Assay System (Promega).
Adenovirus infection and real-time PCR analysis.
Mouse MafB cDNA (28) was used to generate recombinant adenovirus (Ad-MafB) as described previously (39). An adenovirus containing the coding sequences for GFP (Ad-GFP) was used as a control. Purified adenovirus was used to infect 2 x 106 TC-3 and NIH3T3 cells at multiplicities of infection (MOI) ranging from 2 to 100 for 5 h. No change in cell viability was found between adenovirus and mock-infected cells, as was determined by trypan blue staining (Sigma). Total RNA prepared using the RNeasy kit (Qiagen, Valencia, CA), and nuclear extracts were collected from cells 24 h after infection. Isolated RNAs were also subjected to DNaseI treatment using the Versagene RNA DNase kit (Gentra Systems) to remove genomic DNA. TAQMAN RT-PCR reverse transcript reagents (Applied Biosystems) were used to generate cDNAs from 0.5 e蘥 DNase-treated RNA.
PCR mixes were assembled using SYBR Green Master Mix reagents (Applied Biosystems), reactions were performed, and the results were analyzed using the Applied Biosystems Prism 7000 sequence detection system and software. The following mouse cDNA primer sets were used in the amplification step: glucagon top (5'-CATTCACCAGCGACTACAGCAA-3') and glucagon bottom (5'-TCATCAACCACTGCACAAAATCT-3'); insulin I top (5'-GCAAGCAGGTCATTGTTTCAAC-3') and insulin I bottom (5'-AAGCCTGGGTGGGTTTGG-3'); MafB top (5'-CAACAGCTACCCACTAGCCA-3'), insulin II top (5'-CCACCCAGGCTTTTGTCAAA-3'), insulin II bottom (5'-CCCAGCTCCAGTTGTTCCAC-3'), and MafB bottom (5'-GGCGAGTTTCTCGCACTTGA-3'); 18S top (5'-AGTCCCTGCCCTTTGTACACA-3') and 18S bottom (5'-GATCCGAGGGCCTCACTAAAC-3'); and -actin top (5'-GCACCCGGTGCTTCTGAC-3') and -actin bottom (5'-CCAGATGCATACAAGGAC-3').
Electrophoretic mobility shift assays.
Binding analysis was performed with a radiolabeled, wild-type rat glucagon G1 (G1 wild type) site probe (eC77GAAATTTATATTGTCAGCGTAATATCTeC51). Binding reactions (25 e蘬 total volume) were conducted at 4°C for 30 min with 5 e蘬 in vitroeCtranscribed and eCtranslated MafB produced from CMV:MafB and 400 fmol 32P-radiolabeled probe in binding buffer containing 10 mmol/l Tris (pH 8), 100 mmol/l NaCl, 1 mmol/l EDTA, 2 mmol/l dithiothreitol, 10% glycerol, and 1 e蘥 poly(dI-dC). Binding analysis was also conducted with 10 e蘥 nuclear protein prepared from HeLa cells transfected with CMV:Maf (210eC323). Competition assays were performed under the same conditions, except that a 50-fold molar excess of unlabeled wild-type or mutant G1 (eC77GAAATTTATATTGTCGTAATATCTeC51, mutated bases underlined) was added to the reaction along with the probe before the addition of protein. Anti-MafB BL658 (1 e蘥) antibody was incubated with nuclear extract for 30 min on ice before adding the probe. MafB blocking peptide (1 e蘥; Bethyl Laboratories) was incubated with anti-MafB for 30 min on ice before addition of MafB. G1 element binding complexes were resolved on a 5% nondenaturing polyacrylamide gel (acrylamide:bisacrylamide, 29:1) and run in TGE buffer (50 mmol/l Tris, 380 mmol/l glycine, and 2 mmol/l EDTA, pH 8.5). Gels were dried, and binding complexes were visualized by autoradiography.
Chromatin immunoprecipitation assay.
TC-3 cells (2 x 107) infected with Ad-GFP or Ad-MafB at an MOI of 100 or uninfected TC-6 cells (0.5 to 1.0 x 108) were formaldehyde cross-linked, and the sonicated protein-DNA complexes were isolated under conditions described previously (28). Sonicated chromatin was incubated for 1 h at 4°C with anti-MafB BL658 antiserum. Antibody-protein-DNA complexes were isolated by incubation with A/G-agarose (Santa Cruz Biotechnology, Santa Cruz, CA). PCR was performed on one-tenth of the purified immunoprecipitated DNA using Ready-to-Go PCR beads (Amersham Pharmacia Biotech, Rockville, MD) and 15 pmol of each primer (glucagon, eC353CCAAATCAAGGGATAAGACCCTC and +7AAGCTCTGCCCTTCTGCACCAG; and phosphoenolpyruvate carboxykinase [PEPCK], eC434GAGTGACACCTCACAGCTGTGG and eC96GGCAGGCCTTTGGATCATAGCC). The PCRs were performed under the following conditions: one cycle of 95°C for 2 min followed by 28 cycles for 30 s at 95, 61, and 72°C. The correctness of the PCR products was confirmed by sequencing. Amplified products were resolved on a 1.4% agarose gel in Tris-acetate EDTA buffer containing ethidium bromide.
Statistical analysis.
The significance of the experimental findings was determined by Student’s t test from multiple independent comparisons (n > 3). A P value of <0.05 was considered significant.
RESULTS
MafB is exclusively expressed in islet -cells in the adult pancreas.
To determine the distribution of MafB in mouse islets, immunohistochemical studies were performed with anti-MafB BL658, a recently generated peptide-specific antibody. MafB has been reported to be present in - and -cells, but the accuracy of this work was in doubt because of cross-reactivity of the antiserum with the -celleCspecific MafA protein (28). MafB was exclusively detected in glucagon-producing islet cells but not in insulin- or somatostatin-producing cells (Fig. 1). MafB was also occasionally detected in pancreatic polypeptide+ cells (data not shown), which presumably represent rare glucagon+pancreatic polypeptide+ cells (40). In contrast, c-Maf was not detected in islet cells, even though our specific antibody provided the expected c-Maf expression pattern in lens cells (41) (data now shown). Western blot analysis performed with in vitroeCtranscribed and eCtranslated MafA and MafB also confirmed that anti-MafB BL658 only recognized MafB and that anti-MafB P-20 used previously cross-reacted with MafA (data not shown) (28). Anti-MafB BL658 antibody was used for all subsequent studies. Importantly, these results indicated that MafB could be a key transcriptional regulator in islet -cells.
MafB binds the glucagon gene promoter.
Gel mobility shift assays were used to determine whether MafB was capable of specifically binding to the Maf protein binding site found within the G1 control region of the glucagon gene (42), located between nucleotides eC77 and eC51 (Fig. 2A). A unique binding complex was formed in the in vitroeCtranscribed and eCtranslated MafB binding reaction, when compared with the control in vitroeCtranscribed and eCtranslated sample. In competition analysis, wild-type G1 reduced the formation of this complex, whereas a MafB binding-defective mutant did not. In addition, the unique binding complex was super shifted with anti-MafB, an effect prevented by preincubation with the anti-MafB peptide antigen (Fig. 2A). Collectively, these results demonstrated that MafB was capable of selectively binding to the G1 control region of the glucagon gene in vitro.
To determine whether MafB also interacts with proximal control sequences of the endogenous glucagon gene, chromatin immunoprecipitation assays were performed in TC-6 cells. Sequences spanning nucleotides eC353 to +7 of the glucagon gene were PCR amplified from chromatin precipitated with anti-MafB, whereas chromatin treated with normal IgG or in the absence of antibody was not (Fig. 2B). Additionally, anti-MafB was incapable of precipitating control region sequences for PEPCK, a gene not expressed in -cells (data not shown). These results demonstrated that MafB binds directly to regulatory sequences containing the G1 element in the endogenous glucagon gene.
MafB activates glucagon gene transcription.
To test how MafB influences glucagon transcription, we first analyzed how the binding defective eC77- to eC51-bp mutant in the G1 element affected a reporter driven by rat glucagon sequences spanning eC476 to +10 base pairs. The activity of the binding-deficient mutant was reduced to roughly 30% of wild-type activity in TC-6 cells (compare mutant G1 with eC476 GLU in Fig. 3A). Consistent with a role in positive control, the MafB dominant negativeeCacting mutant, MafB (210eC323), inhibited eC476 GLU activity in TC-6 cells (Fig. 3A). MafB (210eC323) lacks an NH2-terminal transactivation domain but still retains the ability to bind specifically, as determined in gel shift competition assays with wild-type and mutant G1 (Fig. 2A). Furthermore, wild-type MafB expression resulted in a 50-fold activation of eC476 GLU in noneCglucagon-expressing HeLa cells, an activity severely attenuated in eC476 GLU G1 mutant (Fig. 3B).
To further investigate MafB activation of the glucagon gene, an adenovirus containing MafB coding sequences (Ad-MafB) was used to overexpress MafB in TC-3 insulinoma cells and the nonislet NIH3T3 cell line. MafB protein and mRNA were effectively induced in a dose-dependent manner in Ad-MafBeCinfected cells, resulting in substantial overexpression compared with control cells infected with the adenovirus encoding GFP (Ad-GFP) (Fig. 4A). MafB levels in uninfected TC-3 cells were low, with expression comparable with endogenous TC-6 cell levels in Ad-MafB 1xeCinfected samples (Fig. 4A; data not shown). In accordance with this pattern, binding of MafB to the G1 element was also augmented in Ad-MafBeCinfected cells (data now shown). The effect of adenoviral delivery of MafB on glucagon gene activation was determined by quantitative real-time PCR. Infection with Ad-MafB resulted in a modest, dose-dependent two- to eightfold increase in endogenous glucagon mRNA levels in TC-3 cells, whereas endogenous insulin, Pdx1, and -actin expression was not influenced significantly (Table 1). In contrast, Ad-MafB did not increase endogenous glucagon mRNA levels in either NIH3T3 (Table 1) or TC-6 cells (data not shown). Chromatin immunoprecipitation experiments also revealed that MafB occupancy of endogenous glucagon G1 control region spanning sequences was increased in TC-3 cells infected with Ad-MafB (Fig. 4B), confirming that the amplification of glucagon gene expression was, at least in part, due to direct transactivation by MafB. Collectively, these results suggest that MafB is a significant activator of glucagon gene expression. In addition, that high-level, -celleClike transcription of the glucagon gene involves cooperation between MafB with other distinct cell enriched factors.
MafB is expressed in - and -cells during development.
MafB expression was next analyzed during pancreas development by immunohistochemistry (Fig. 5). Expression was initially observed in glucagon+ cells at E10.5. MafB was also detected in the early insulin-producing cells at E12.5, and expression persisted in glucagon- and insulin-producing cells throughout pancreas development (Fig. 5) but was not found in either somatostatin or pancreatic polypeptide cells (data not shown). These results establish that MafB is selectively produced in insulin+ and glucagon+ islet progenitor cells during pancreas development.
MafB becomes progressively restricted to -cells postnatally because expression in -cells is downregulated within 2 weeks of birth and is undetectable in these cells by 3 weeks (Fig. 5; data not shown). To further characterize the transition between differentiating insulin-producing cells (MafB+) and mature -cells (MafBeC), colocalization of MafB with Pdx1 was examined at E18.5 and P4. Pdx1 is principally expressed in insulin+ cells and not glucagon+ cells at these times (43). As expected, only a few Pdx1+MafB+ cells were detected (Fig. 6A). In contrast to the pancreas, MafB was expressed in essentially all Pdx1+ cells along the villi of the duodenum at P4 and at lower levels in many Pdx1+ cells in the duodenal crypts (Fig. 6A). This pattern indicates that MafB may also be contributing in the duodenum to transcription of large Maf-regulated genes like pdx1.
MafB is expressed in endocrine progenitor cells within the developing pancreas.
MafB expression was also detected in some surrounding noneChormone-expressing cells between E12.5 and E18.5 (data not shown), potentially representing the MafB+Neurogenin3+ islet progenitor cells detected by microarray analysis (44). Costaining of MafB and Neurogenin3+ (Ngn3+) supported this hypothesis because MafB was found in a fraction of the Ngn3+ cells at early endocrine differentiation stages (Fig. 6B). The presence of MafB in Ngn3+ cells, a transcription factor essential for the production of all islet cell types (45), suggests that MafB may be present in proliferating islet progenitor cells. Coexpression of MafB and ki67, a marker for dividing cells, was found in some MafB+ cells throughout development (Fig. 6C). At E13.5, the MafB+ki67+ cells are readily detectable, but these cells become less abundant at E15.5 and E18.5. Because glucagon and insulin are not expressed in replicating cells during pancreatogenesis (46,47), these observations suggest that MafB is expressed in both dividing and nondividing islet progenitor cells.
MafB expression is maintained in insulin- and glucagon-producing cells of Pax4- and Pax6-deficient animals.
To provide insight into when MafB acts during pancreatic development, expression was analyzed in Pax4- and Pax6-deficient mice. The vast majority of - and -cells (22) are lost in pax4 mutant mice, whereas glucagon- and insulin-producing cell numbers are severely reduced in both Pax6eC/eC (19,20) and Pax6 sey/sey (12) animals. The Pax6 sey/sey mutation prevents translation of a functional protein (38). MafB expression was observed in the insulin+ and glucagon+ cells remaining in Pax4 and Pax6 sey/sey mutants at E15.5 (Fig. 7), indicating that neither Pax4 nor Pax6 is required for MafB expression. These results may also indicate that MafB can participate in gene regulation early in - and -cell development, before Pax4 and Pax6 expression.
DISCUSSION
Large Maf proteins are involved in regulating the transcription of genes important to cell typeeCspecific expression and differentiation. MafA has been identified as a -celleCspecific activator of the insulin gene (28eC30) and was recently found to be critical to glucose-stimulated insulin secretion in vivo (33). In addition to MafA, the closely related MafB protein is also capable of activating insulin gene expression (28). In this study, we have shown that MafB can also specifically activate glucagon gene expression in cell culture-based assays and directly binds to the control region of the endogenous glucagon gene. In addition, MafB was coexpressed with insulin and glucagon during pancreatogenesis and in early replicating noneChormone-producing cells. Collectively, our data suggest that MafB may be involved in both - and -cell formation and islet -cell function.
Immunohistochemical analysis with the newly available peptide-specific antibody BL658 revealed that MafB is only present in islet -cells within the adult pancreas (Fig. 1). The previous detection of MafB in islet -cells most likely represents cross-reactivity with MafA (28). The unique presence of MafB in -cells strongly indicates a key role in -cell function. Our transfection and gel shift results strongly suggest that MafB activates glucagon gene expression through the G1 element at bp eC77 to eC51. However, c-Maf has also recently been proposed to stimulate glucagon expression (48). Because this suggestion was primarily based on studies in cell lines and due to our inability to detect c-Maf in islet cells (data not shown), we do not believe that this factor regulates glucagon expression in vivo. c-Maf mRNA levels are a small fraction of MafA (1 of 100) and MafB (1 of 50) in the islet (28). Presumably, the c-Maf mRNA present in islet samples (28) was either due to relatively low levels of expression in islet cells and/or due to contamination from blood cells present in these highly vascularized structures (37). Most significantly, MafB was shown to specifically bind to sequences associated with control of the endogenous glucagon gene in the islet -cell line, TC-6 (Fig. 2).
Adenoviral-mediated overexpression of MafB in TC-3 cells resulted in activation of endogenous glucagon gene expression (Table 1). Although commonly considered to represent a -cell line, TC-3 cells also express low levels of both glucagon and MafB. Strikingly, Ad-MafB failed to activate insulin and pdx1 in TC-3 cells, two large Maf protein target genes associated with -cell identity (49). This may indicate that large Maf protein activity is not limiting to transcription of these genes in this -cell line. In contrast to insulin or pdx1, glucagon is expressed very inefficiently in TC-3 cells and hence may be more sensitive to MafB-mediated activation. Similarly, glucagon expression was not induced by Ad-MafB in TC-6 cells, presumably because of high-level expression in this -cell line. On the other hand, the inability of MafB to activate -cell genes may reflect an unappreciated specificity of action between large Maf proteins, which are generally thought to be functionally interchangeable in vitro (28). Glucagon mRNA expression induced by Ad-MafB in TC-3 cells was also very low relative to -cells (data not shown), suggesting that other cell-enriched factors act together with MafB to stimulate high-level gene transcription (e.g., Brn4) (50). This proposal is consistent with both our inability to activate glucagon in either TC-6 or NIH3T3 cells (Table 1; data not shown) and the absence of glucagon in developing insulin+/MafB+ cells (Fig. 5).
During pancreas development, MafB was initially detected in glucagon+ cells by E10.5 and in insulin+ cells by E12.5 (Fig. 5). Interestingly, MafB becomes progressively restricted to -cells postnatally because expression in -cells is undetectable within 2 weeks of birth. Although it is unclear why MafB is lost in -cells during this time, this period coincides with profound morphological and physiological changes to islet cells. Thus, -, -, -, and pancreatic polypeptide cells arrange into the mature islet configuration, with -cells in the core and other cells at the periphery, and migrate away from ductal structures. In addition, and perhaps most importantly, the glucose responsiveness of -cells is established at this time (6).
The MafB expression pattern is unique because no other known pancreatic transcription factor is expressed in only - and -cell progenitors and then becomes restricted to -cells postnatally. In general, the transcription factors important to the islet can be grouped according to their expression pattern within the developing pancreas. Thus, such transcription factors have been found in early nonhormone progenitor cells (i.e., Ngn3), cells that produce each of the endocrine hormones (NeuroD1, Isl1, and Pax6) as well as in a specific hormone-producing cell type and its progenitors (Nkx6.1, Nkx2.2, Pax4, ARX, and Brn4) (51,52). However, none of these patterns apply to MafB or the closely related MafA transcription factor, which is only found in insulin-producing cells of the secondary transition and mature islet -cells (28,32). MafB was also the most highly expressed gene within the islet among the 27 found within the susceptibility locus for type 2 diabetes on human chromosome 20 (53). Significantly, the transient expression of MafB in differentiating and immature insulin-producing cells implies its likely involvement in regulation of genes important to -cell development, whereas the persistent presence in glucagon+ cells indicates a more fundamental role for MafB in islet -cells.
MafB and Ngn3 expression domains partially overlapped during early pancreas development (Fig. 5), possibly indicating that proliferating MafB+ cells represent MafB+/Ngn3+/hormoneeC progenitor cells (Fig. 8). This proposal is consistent with the essential but transient nature of Ngn3 in islet cell formation. In addition, the maintenance of expression in the insulin+ and glucagon+ cells of Pax4- and Pax6-deficient mice implies an early role in transcriptional regulation in both - and -cell development. Alternatively, MafB could act in parallel with Pax4 and Pax6 in developing - and -cells. Unfortunately, MafB-deficient mouse lines have not been examined for islet phenotypes (34), an analysis that will be essential for fully understanding the importance of MafB in - and -cell formation and function. Based on our observations, however, defects in the formation of both insulin+ and glucagon+ cells in the developing pancreas of these animals are predicted, as well as long-term deficiencies in proper regulation of glucose metabolism.
ACKNOWLEDGMENTS
R.S. has received National Institutes of Health Grant P01-DK-42502 and American Diabetes Association Grant 7-04-RA-116. B.S.-P. has received National Institutes of Health Grant U19-DK-42502 VUMC#9,183. I.A. has received Juvenile Diabetes Research Foundation Postdoctoral Grant 3-2003-579. L.E. has received support from the American Lebanese Syrian Associated Charities. Partial support was also provided to the Molecular Biology Core Laboratory by the Vanderbilt University Diabetes Research and Training Center (Public Health Service Grant P60-DK-20593).
The wild-type eC476 GLU reporter construct was a gift of Dr. Dan Drucker, goat anti-Pdx1 antibody was provided by Dr. C.V.E. Wright, and guinea pig anti-Ngn3 was obtained from Dr. M. Sander.
FOOTNOTES
I.A. and J.L. contributed equally to this study.
REFERENCES
Steiner DF, Bell GI, Rubenstein AH, Chan SJ: Chemistry and biosynthesis of the islet hormones: insulin, islet amyloid polypeptide (Amylin), glucagon, somatostatin, and pancreatic polypeptide. In Endocrinology. DeGroot LJ, Jameson JL, Eds. Philadelphia, Saunders, 2001, p.667eC696
Herrera PL, Huarte J, Sanvito F, Meda P, Orci L, Vassalli JD: Embryogenesis of the murine endocrine pancreas: early expression of pancreatic polypeptide gene. Development 113:1257eC1265, 1991
Teitelman G, Alpert S, Polak JM, Martinez A, Hanahan D: Precursor cells of mouse endocrine pancreas coexpress insulin, glucagon and the neuronal proteins tyrosine hydroxylase and neuropeptide Y, but not pancreatic polypeptide. Development 118:1031eC1039, 1993
Upchurch BH, Aponte GW, Leiter AB: Expression of peptide YY in all four islet cell types in the developing mouse pancreas suggests a common peptide YY-producing progenitor. Development 120:245eC252, 1994
Pictet RL, Clark WR, Williams RH, Rutter WJ: An ultrastructural analysis of the developing embryonic pancreas. Dev Biol 29:436eC467, 1972
Hole RL, Pian-Smith MC, Sharp GW: Development of the biphasic response to glucose in fetal and neonatal rat pancreas. Am J Physiol 254:E167eCE174, 1988
Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR: Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275eC1283, 1993
Ohlsson H, Karlsson K, Edlund T: IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251eC4259, 1993
Miller CP, McGehee RE Jr, Habener JF: IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145eC1156, 1994
Cissell MA, Zhao L, Sussel L, Henderson E, Stein R: Transcription factor occupancy of the insulin gene in vivo: evidence for direct regulation by Nkx2.2. J Biol Chem 278:751eC756, 2003
Ritz-Laser B, Estreicher A, Klages N, Saule S, Philippe J: Pax-6 and Cdx-2/3 interact to activate glucagon gene expression on the G1 control element. J Biol Chem 274:4124eC4132, 1999
Sander M, Neubuser A, Kalamaras J, Ee HC, Martin GR, German MS: Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development. Genes Dev 11:1662eC1673, 1997
Smith SB, Ee HC, Conners JR, German MS: Paired-homeodomain transcription factor PAX4 acts as a transcriptional repressor in early pancreatic development. Mol Cell Biol 19:8272eC8280, 1999
Fujitani Y, Kajimoto Y, Yasuda T, Matsuoka TA, Kaneto H, Umayahara Y, Fujita N, Watada H, Miyazaki JI, Yamasaki Y, Hori M: Identification of a portable repression domain and an E1A-responsive activation domain in Pax4: a possible role of Pax4 as a transcriptional repressor in the pancreas. Mol Cell Biol 19:8281eC8291, 1999
Naya FJ, Stellrecht CM, Tsai MJ: Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9:1009eC1019, 1995
Dumonteil E, Laser B, Constant I, Philippe J: Differential regulation of the glucagon and insulin I gene promoters by the basic helix-loop-helix transcription factors E47 and BETA2. J Biol Chem 273:19945eC19954, 1998
Ahlgren U, Jonsson J, Edlund H: The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development 122:1409eC1416, 1996
Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL, Wright CV: PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983eC995, 1996
St-Onge L, Sosa-Pineda B, Chowdhury K, Mansouri A, Gruss P: Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature 387:406eC409, 1997
Ashery-Padan R, Zhou X, Marquardt T, Herrera P, Toube L, Berry A, Gruss P: Conditional inactivation of Pax6 in the pancreas causes early onset of diabetes. Dev Biol 269:479eC488, 2004
Wang J, Elghazi L, Parker SE, Kizilocak H, Asano M, Sussel L, Sosa-Pineda B: The concerted activities of Pax4 and Nkx2.2 are essential to initiate pancreatic beta-cell differentiation. Dev Biol 266:178eC189, 2004
Sosa-Pineda B, Chowdhury K, Torres M, Oliver G, Gruss P: The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386:399eC402, 1997
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev 11:2323eC2334, 1997
Stoffers DA, Ferrer J, Clarke WL, Habener JF: Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat Genet 17:138eC139, 1997
Yasuda T, Kajimoto Y, Fujitani Y, Watada H, Yamamoto S, Watarai T, Umayahara Y, Matsuhisa M, Gorogawa S, Kuwayama Y, Tano Y, Yamasaki Y, Hori M: PAX6 mutation as a genetic factor common to aniridia and glucose intolerance. Diabetes 51:224eC230, 2002
Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet 23:323eC328, 1999
Kaneto H, Matsuoka TA, Nakatani Y, Miyatsuka T, Matsuhisa M, Hori M, Yamasaki Y: A crucial role of MafA as a novel therapeutic target for diabetes. J Biol Chem 280:15047eC15052, 2005
Matsuoka TA, Zhao L, Artner I, Jarrett HW, Friedman D, Means A, Stein R: Members of the large Maf transcription family regulate insulin gene transcription in islet beta cells. Mol Cell Biol 23:6049eC6062, 2003
Kataoka K, Han SI, Shioda S, Hirai M, Nishizawa M, Handa H: MafA is a glucose-regulated and pancreatic beta-cell-specific transcriptional activator for the insulin gene. J Biol Chem 277:49903eC49910, 2002
Olbrot M, Rud J, Moss LG, Sharma A: Identification of beta-cell-specific insulin gene transcription factor RIPE3b1 as mammalian MafA. Proc Natl Acad Sci U S A 99:6737eC6742, 2002
Zhao L, Guo M, Matsuoka TA, Hagman DK, Parazzoli SD, Poitout V, Stein R: The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 280:11887eC11894, 2005
Matsuoka TA, Artner I, Henderson E, Means A, Sander M, Stein R: The MafA transcription factor appears to be responsible for tissue-specific expression of insulin. Proc Natl Acad Sci U S A 101:2930eC2933, 2004
Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, Kudo T, Engel JD, Yamamoto M, Takahashi S: MafA is a key regulator of glucose-stimulated insulin secretion. Mol Cell Biol 25:4969eC4976, 2005
Blanchi B, Kelly LM, Viemari JC, Lafon I, Burnet H, Bevengut M, Tillmanns S, Daniel L, Graf T, Hilaire G, Sieweke MH: MafB deficiency causes defective respiratory rhythmogenesis and fatal central apnea at birth. Nat Neurosci 6:1091eC1100, 2003
Sadl VS, Sing A, Mar L, Jin F, Cordes SP: Analysis of hindbrain patterning defects caused by the kreisler(enu) mutation reveals multiple roles of Kreisler in hindbrain segmentation. Dev Dyn 227:134eC142, 2003
MacLean HE, Kim JI, Glimcher MJ, Wang J, Kronenberg HM, Glimcher LH: Absence of transcription factor c-maf causes abnormal terminal differentiation of hypertrophic chondrocytes during endochondral bone development. Dev Biol 262:51eC63, 2003
Cao S, Liu J, Chesi M, Bergsagel PL, Ho IC, Donnelly RP, Ma X: Differential regulation of IL-12 and IL-10 gene expression in macrophages by the basic leucine zipper transcription factor c-Maf fibrosarcoma. J Immunol 169:5715eC5725, 2002
Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, Prosser J, Jordan T, Hastie ND, van Heyningen V: Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354:522eC525, 1991
Becker TC, Noel RJ, Coats WS, Gomez-Foix AM, Alam T, Gerard RD, Newgard CB: Use of recombinant adenovirus for metabolic engineering of mammalian cells. Methods Cell Biol 43:161eC189, 1994
Heller RS, Stoffers DA, Liu A, Schedl A, Crenshaw EB III, Madsen OD, Serup P: The role of Brn4/Pou3f4 and Pax6 in forming the pancreatic glucagon cell identity. Dev Biol 268:123eC134, 2004
Sakai M, Imaki J, Yoshida K, Ogata A, Matsushima-Hibaya Y, Kuboki Y, Nishizawa M, Nishi S: Rat maf related genes: specific expression in chondrocytes, lens and spinal cord. Oncogene 14:745eC750, 1997
Planque N, Leconte L, Coquelle FM, Benkhelifa S, Martin P, Felder-Schmittbuhl MP, Saule S: Interaction of Maf transcription factors with Pax-6 results in synergistic activation of the glucagon promoter. J Biol Chem 276:35751eC35760, 2001
Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CV, Teitelman G: Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11eC18, 1995
Gu G, Wells JM, Dombkowski D, Preffer F, Aronow B, Melton DA: Global expression analysis of gene regulatory pathways during endocrine pancreatic development. Development 131:165eC179, 2004
Gradwohl G, Dierich A, LeMeur M, Guillemot F: neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97:1607eC1611, 2000
Jensen J, Heller RS, Funder-Nielsen T, Pedersen EE, Lindsell C, Weinmaster G, Madsen OD, Serup P: Independent development of pancreatic - and -cells from neurogenin3-expressing precursors: a role for the notch pathway in repression of premature differentiation. Diabetes 49:163eC176, 2000
Schwitzgebel VM, Scheel DW, Conners JR, Kalamaras J, Lee JE, Anderson DJ, Sussel L, Johnson JD, German MS: Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127:3533eC3542, 2000
Kataoka K, Shioda S, Ando K, Sakagami K, Handa H, Yasuda K: Differentially expressed Maf family transcription factors, c-Maf and MafA, activate glucagon and insulin gene expression in pancreatic islet alpha- and beta-cells. J Mol Endocrinol 32:9eC20, 2004
Samaras SE, Zhao L, Means A, Henderson E, Matsuoka TA, Stein R: The islet beta cell-enriched RIPE3b1/Maf transcription factor regulates pdx-1 expression. J Biol Chem 278:12263eC12270, 2003
Hussain MA, Miller CP, Habener JF: Brn-4 transcription factor expression targeted to the early developing mouse pancreas induces ectopic glucagon gene expression in insulin-producing beta cells. J Biol Chem 277:16028eC16032, 2002
Collombat P, Mansouri A, Hecksher-Sorensen J, Serup P, Krull J, Gradwohl G, Gruss P: Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev 17:2591eC2603, 2003
Wilson ME, Scheel D, German MS: Gene expression cascades in pancreatic development. Mech Dev 120:65eC80, 2003
Permutt MA, Wasson J, Love-Gregory L, Ma J, Skolnick G, Suarez B, Lin J, Glaser B: Searching for type 2 diabetes genes on chromosome 20. Diabetes 51 (Suppl. 3):S308eCS315, 2002(Isabella Artner, John Le )
2 Department of Genetics, St. Jude Children’s Research Hospital, Memphis, Tennessee
3 Sarah W. Stedman Nutrition and Metabolism Center, Duke University Medical Center, Durham, North Carolina
Key Words: CMV, cytomegalovirus MOI, multiplicity of infection PEPCK, phosphoenolpyruvate carboxykinase
ABSTRACT
The large Maf family of basic leucine-zippereCcontaining transcription factors are known regulators of key developmental and functional processes in various cell types, including pancreatic islets. Here, we demonstrate that within the adult pancreas, MafB is only expressed in islet -cells and contributes to cell typeeCspecific expression of the glucagon gene through activation of a conserved control element found between nucleotides eC77 to eC51. MafB was also shown to be expressed in developing - and -cells as well as in proliferating hormone-negative cells during pancreatogenesis. In addition, MafB expression is maintained in the insulin+ and glucagon+ cells remaining in mice lacking either the Pax4 or Pax6 developmental regulators, implicating a potentially early role for MafB in gene regulation during islet cell development. These results indicate that MafB is not only important to islet -cell function but may also be involved in regulating genes required in both endocrine - and -cell differentiation.
The pancreatic islets of Langerhans are composed of -, -, -, and pancreatic polypeptide cells, which independently produce the hormones glucagon, insulin, somatostatin, and pancreatic polypeptide, respectively. Collectively, these hormones regulate both fuel and energy metabolism, with insulin and glucagon key to controlling glucose homeostasis (1). Thus, glucagon secreted from -cells stimulates the mobilization of glucose through gluconeogenesis and glycogenolysis to prevent hypoglycemia, whereas -celleCsecreted insulin promotes glucose storage. Physiological glucose levels are maintained through the counter-regulatory actions of glucagon and insulin in peripheral tissues, with defects in - and -cell function playing a significant part in the ability of diabetic patients to maintain glycemic control.
The identification and characterization of the transcription factors regulating insulin and glucagon expression have not only revealed their significance in islet function but also during pancreatogenesis. The pancreas develops from dorsal and ventral epithelial bud evaginations from the foregut, with glucagon-producing cells first appearing at mouse embryonic day (E) 9.5 in the dorsal bud (2eC4). Insulin-producing cells emerge at E10.5 (3), whereas somatostatin and pancreatic polypeptide+ cells are not detected until E15.5 and E18.5, respectively (5). Insulin- and glucagon-producing cells appear in waves during development, with the functional - and -cells that will populate the islet produced starting at E13.5 (5). This latter phase is termed the "secondary transition," and these cells continue to proliferate but are only organized into islet structures and become glucose-responsive shortly after birth (6).
The transcription factors associated with controlling cell-specific expression of the insulin and glucagon genes are principal regulators of islet cell formation, including Pdx1 (7eC10), Pax6 (11,12), Pax4 (13,14), and NeuroD1 (15,16). Pdx1 is necessary for the growth of the endocrine and exocrine compartments, with pancreatic agenesis observed in pdx1 mutant mice (17,18). In contrast, the loss of pax6 (12,19,20), pax4 (21,22), and neuroD1 (23) only affects islet cell development. Heterozygous mutations in Pdx1 (24), Pax6 (25), and NeuroD1 (26) also contribute to the formation of diabetes in humans, establishing a key conserved role for these factors in islet cell activity.
MafA is another essential activator of the insulin gene (27eC31). Specific roles for MafA in processes important to islet cell formation and function have been suggested upon observing that MafA is first produced in insulin-producing cells of the secondary transition and was also capable of independently inducing insulin expression in noneC-cells (27,32). Its significance to -cell function has recently been confirmed in MafA-deficient mice, which are glucose intolerant and develop diabetes (33). Interestingly, no developmental islet cell phenotype was reported in MafAeC/eC animals, a surprise considering its embryonic expression pattern and that all other closely related members of the large Maf transcription factor family are associated with processes necessary for cell formation, including the brain (i.e., MafB [34,35]), cartilage (c-Maf [36]), and immune system (c-Maf [37]).
In addition to MafA, MafB is capable of activating insulin enhancereCdriven expression in noneCislet cell transfection assays, even though MafB is primarily found in islet -cells (28). The members of the large Maf transcription factor family all share a highly conserved NH2-terminal activation domain and a COOH-terminal basic leucine-zipper DNA-binding domain. Here, we show that MafB is an important regulator of glucagon gene expression. Thus, MafB was found to bind to and activate at conserved nucleotides eC77 to eC51 of the -celleCspecific promoter control element (termed G1). MafB was also capable of specifically activating endogenous glucagon expression when overexpressed in a -cell line. Furthermore, MafB was present in both insulin- and glucagon-producing cells during development, with expression only restricted to -cells soon after birth. Our data imply that MafB may be involved in regulating genes integral to islet - and -cell formation, with a long-term role in glucagon transcription in islets.
RESEARCH DESIGN AND METHODS
Immunohistochemistry.
Adult tissue and staged embryos were obtained from wild-type (Balb/c), Pax4eC/eC (22), and Pax6 seyNEU/seyNEU (38) mice (sey/sey). The day of vaginal-plug discovery was designated stage E0.5. Immunofluorescence and confocal image analyses were performed on paraffin sections as described previously (28). The primary antibodies used were rabbit anti-MafB (1:5,000; Bethyl Laboratories BL658, Montgomery, TX), goat anti-Pdx1 (1:10,000), mouse anti-ki67 (1:500; BD Biosciences, San Jose, CA), guinea pig anti-Ngn3 (1:1,000), guinea pig anti-insulin (1:2,000; Linco Research, St. Charles, MO), guinea pig anti-glucagon (1:2,000; Linco Research), guinea pig antieCpancreatic polypeptide (1:2,000; Linco Research), and sheep anti-somatostatin (1:2,000; American Research Products, Belmont, MA). Secondary antibodies were Cy3- or Cy5-conjugated donkey antieCguinea pig, anti-sheep, anti-goat, and anti-rabbit IgG (1:500; Jackson ImmunoResearch, West Grove, PA). Fluorescent images were captured with a Zeiss LSM 510 confocal microscope using an optical depth of 1 e蘭. Nuclear counterstaining was performed using YoPro1 (Molecular Probes, Eugene, OR).
DNA constructs and transfection assays.
The glucagon eC476 luciferase reporter (eC476 GLU) contains rat glucagon gene sequences from nucleotides eC476 to +10. The glucagon G1 mutant was generated in eC476 GLU using the Quick Change mutagenesis kit (Stratagene, La Jolla, CA) with the rat G1 MUTeC73ATTTATATTGTCGTAATATCTGCAeC47 oligonucleotide; the mutated sequence is underlined. The construction of the cytomegalovirus (CMV)-driven MafB expression construct (CMV:MafB) in pcDNA3.1 has been described previously (28). An expression construct encoding amino acids 210eC323 of MafB (CMV:MafB [210eC323]) was prepared by PCR amplification (top primer, 5'-ATGCGCTTCTCTGATGACCAGCTGG-3'; bottom primer, 5'-TCACAGAAAGAACTCAGGAGAGG-3') and subcloned into pcDNA3.1 (Invitrogen). All mutated constructs were verified by sequencing.
Monolayer cultures of HeLa and TC-6 were maintained as described previously (28,32). Transfections were performed using the lipofectamine reagent (Invitrogen) under the manufacturer’s conditions. Extracts from cells were prepared 40 to 48 h after transfection and analyzed for glucagon-driven firefly luciferase and thymidine kinaseeCdriven renilla luciferase (i.e., using phRL-TK; Promega, Madison, WI) activity using the Dual-Luciferase Reporter Assay System (Promega).
Adenovirus infection and real-time PCR analysis.
Mouse MafB cDNA (28) was used to generate recombinant adenovirus (Ad-MafB) as described previously (39). An adenovirus containing the coding sequences for GFP (Ad-GFP) was used as a control. Purified adenovirus was used to infect 2 x 106 TC-3 and NIH3T3 cells at multiplicities of infection (MOI) ranging from 2 to 100 for 5 h. No change in cell viability was found between adenovirus and mock-infected cells, as was determined by trypan blue staining (Sigma). Total RNA prepared using the RNeasy kit (Qiagen, Valencia, CA), and nuclear extracts were collected from cells 24 h after infection. Isolated RNAs were also subjected to DNaseI treatment using the Versagene RNA DNase kit (Gentra Systems) to remove genomic DNA. TAQMAN RT-PCR reverse transcript reagents (Applied Biosystems) were used to generate cDNAs from 0.5 e蘥 DNase-treated RNA.
PCR mixes were assembled using SYBR Green Master Mix reagents (Applied Biosystems), reactions were performed, and the results were analyzed using the Applied Biosystems Prism 7000 sequence detection system and software. The following mouse cDNA primer sets were used in the amplification step: glucagon top (5'-CATTCACCAGCGACTACAGCAA-3') and glucagon bottom (5'-TCATCAACCACTGCACAAAATCT-3'); insulin I top (5'-GCAAGCAGGTCATTGTTTCAAC-3') and insulin I bottom (5'-AAGCCTGGGTGGGTTTGG-3'); MafB top (5'-CAACAGCTACCCACTAGCCA-3'), insulin II top (5'-CCACCCAGGCTTTTGTCAAA-3'), insulin II bottom (5'-CCCAGCTCCAGTTGTTCCAC-3'), and MafB bottom (5'-GGCGAGTTTCTCGCACTTGA-3'); 18S top (5'-AGTCCCTGCCCTTTGTACACA-3') and 18S bottom (5'-GATCCGAGGGCCTCACTAAAC-3'); and -actin top (5'-GCACCCGGTGCTTCTGAC-3') and -actin bottom (5'-CCAGATGCATACAAGGAC-3').
Electrophoretic mobility shift assays.
Binding analysis was performed with a radiolabeled, wild-type rat glucagon G1 (G1 wild type) site probe (eC77GAAATTTATATTGTCAGCGTAATATCTeC51). Binding reactions (25 e蘬 total volume) were conducted at 4°C for 30 min with 5 e蘬 in vitroeCtranscribed and eCtranslated MafB produced from CMV:MafB and 400 fmol 32P-radiolabeled probe in binding buffer containing 10 mmol/l Tris (pH 8), 100 mmol/l NaCl, 1 mmol/l EDTA, 2 mmol/l dithiothreitol, 10% glycerol, and 1 e蘥 poly(dI-dC). Binding analysis was also conducted with 10 e蘥 nuclear protein prepared from HeLa cells transfected with CMV:Maf (210eC323). Competition assays were performed under the same conditions, except that a 50-fold molar excess of unlabeled wild-type or mutant G1 (eC77GAAATTTATATTGTCGTAATATCTeC51, mutated bases underlined) was added to the reaction along with the probe before the addition of protein. Anti-MafB BL658 (1 e蘥) antibody was incubated with nuclear extract for 30 min on ice before adding the probe. MafB blocking peptide (1 e蘥; Bethyl Laboratories) was incubated with anti-MafB for 30 min on ice before addition of MafB. G1 element binding complexes were resolved on a 5% nondenaturing polyacrylamide gel (acrylamide:bisacrylamide, 29:1) and run in TGE buffer (50 mmol/l Tris, 380 mmol/l glycine, and 2 mmol/l EDTA, pH 8.5). Gels were dried, and binding complexes were visualized by autoradiography.
Chromatin immunoprecipitation assay.
TC-3 cells (2 x 107) infected with Ad-GFP or Ad-MafB at an MOI of 100 or uninfected TC-6 cells (0.5 to 1.0 x 108) were formaldehyde cross-linked, and the sonicated protein-DNA complexes were isolated under conditions described previously (28). Sonicated chromatin was incubated for 1 h at 4°C with anti-MafB BL658 antiserum. Antibody-protein-DNA complexes were isolated by incubation with A/G-agarose (Santa Cruz Biotechnology, Santa Cruz, CA). PCR was performed on one-tenth of the purified immunoprecipitated DNA using Ready-to-Go PCR beads (Amersham Pharmacia Biotech, Rockville, MD) and 15 pmol of each primer (glucagon, eC353CCAAATCAAGGGATAAGACCCTC and +7AAGCTCTGCCCTTCTGCACCAG; and phosphoenolpyruvate carboxykinase [PEPCK], eC434GAGTGACACCTCACAGCTGTGG and eC96GGCAGGCCTTTGGATCATAGCC). The PCRs were performed under the following conditions: one cycle of 95°C for 2 min followed by 28 cycles for 30 s at 95, 61, and 72°C. The correctness of the PCR products was confirmed by sequencing. Amplified products were resolved on a 1.4% agarose gel in Tris-acetate EDTA buffer containing ethidium bromide.
Statistical analysis.
The significance of the experimental findings was determined by Student’s t test from multiple independent comparisons (n > 3). A P value of <0.05 was considered significant.
RESULTS
MafB is exclusively expressed in islet -cells in the adult pancreas.
To determine the distribution of MafB in mouse islets, immunohistochemical studies were performed with anti-MafB BL658, a recently generated peptide-specific antibody. MafB has been reported to be present in - and -cells, but the accuracy of this work was in doubt because of cross-reactivity of the antiserum with the -celleCspecific MafA protein (28). MafB was exclusively detected in glucagon-producing islet cells but not in insulin- or somatostatin-producing cells (Fig. 1). MafB was also occasionally detected in pancreatic polypeptide+ cells (data not shown), which presumably represent rare glucagon+pancreatic polypeptide+ cells (40). In contrast, c-Maf was not detected in islet cells, even though our specific antibody provided the expected c-Maf expression pattern in lens cells (41) (data now shown). Western blot analysis performed with in vitroeCtranscribed and eCtranslated MafA and MafB also confirmed that anti-MafB BL658 only recognized MafB and that anti-MafB P-20 used previously cross-reacted with MafA (data not shown) (28). Anti-MafB BL658 antibody was used for all subsequent studies. Importantly, these results indicated that MafB could be a key transcriptional regulator in islet -cells.
MafB binds the glucagon gene promoter.
Gel mobility shift assays were used to determine whether MafB was capable of specifically binding to the Maf protein binding site found within the G1 control region of the glucagon gene (42), located between nucleotides eC77 and eC51 (Fig. 2A). A unique binding complex was formed in the in vitroeCtranscribed and eCtranslated MafB binding reaction, when compared with the control in vitroeCtranscribed and eCtranslated sample. In competition analysis, wild-type G1 reduced the formation of this complex, whereas a MafB binding-defective mutant did not. In addition, the unique binding complex was super shifted with anti-MafB, an effect prevented by preincubation with the anti-MafB peptide antigen (Fig. 2A). Collectively, these results demonstrated that MafB was capable of selectively binding to the G1 control region of the glucagon gene in vitro.
To determine whether MafB also interacts with proximal control sequences of the endogenous glucagon gene, chromatin immunoprecipitation assays were performed in TC-6 cells. Sequences spanning nucleotides eC353 to +7 of the glucagon gene were PCR amplified from chromatin precipitated with anti-MafB, whereas chromatin treated with normal IgG or in the absence of antibody was not (Fig. 2B). Additionally, anti-MafB was incapable of precipitating control region sequences for PEPCK, a gene not expressed in -cells (data not shown). These results demonstrated that MafB binds directly to regulatory sequences containing the G1 element in the endogenous glucagon gene.
MafB activates glucagon gene transcription.
To test how MafB influences glucagon transcription, we first analyzed how the binding defective eC77- to eC51-bp mutant in the G1 element affected a reporter driven by rat glucagon sequences spanning eC476 to +10 base pairs. The activity of the binding-deficient mutant was reduced to roughly 30% of wild-type activity in TC-6 cells (compare mutant G1 with eC476 GLU in Fig. 3A). Consistent with a role in positive control, the MafB dominant negativeeCacting mutant, MafB (210eC323), inhibited eC476 GLU activity in TC-6 cells (Fig. 3A). MafB (210eC323) lacks an NH2-terminal transactivation domain but still retains the ability to bind specifically, as determined in gel shift competition assays with wild-type and mutant G1 (Fig. 2A). Furthermore, wild-type MafB expression resulted in a 50-fold activation of eC476 GLU in noneCglucagon-expressing HeLa cells, an activity severely attenuated in eC476 GLU G1 mutant (Fig. 3B).
To further investigate MafB activation of the glucagon gene, an adenovirus containing MafB coding sequences (Ad-MafB) was used to overexpress MafB in TC-3 insulinoma cells and the nonislet NIH3T3 cell line. MafB protein and mRNA were effectively induced in a dose-dependent manner in Ad-MafBeCinfected cells, resulting in substantial overexpression compared with control cells infected with the adenovirus encoding GFP (Ad-GFP) (Fig. 4A). MafB levels in uninfected TC-3 cells were low, with expression comparable with endogenous TC-6 cell levels in Ad-MafB 1xeCinfected samples (Fig. 4A; data not shown). In accordance with this pattern, binding of MafB to the G1 element was also augmented in Ad-MafBeCinfected cells (data now shown). The effect of adenoviral delivery of MafB on glucagon gene activation was determined by quantitative real-time PCR. Infection with Ad-MafB resulted in a modest, dose-dependent two- to eightfold increase in endogenous glucagon mRNA levels in TC-3 cells, whereas endogenous insulin, Pdx1, and -actin expression was not influenced significantly (Table 1). In contrast, Ad-MafB did not increase endogenous glucagon mRNA levels in either NIH3T3 (Table 1) or TC-6 cells (data not shown). Chromatin immunoprecipitation experiments also revealed that MafB occupancy of endogenous glucagon G1 control region spanning sequences was increased in TC-3 cells infected with Ad-MafB (Fig. 4B), confirming that the amplification of glucagon gene expression was, at least in part, due to direct transactivation by MafB. Collectively, these results suggest that MafB is a significant activator of glucagon gene expression. In addition, that high-level, -celleClike transcription of the glucagon gene involves cooperation between MafB with other distinct cell enriched factors.
MafB is expressed in - and -cells during development.
MafB expression was next analyzed during pancreas development by immunohistochemistry (Fig. 5). Expression was initially observed in glucagon+ cells at E10.5. MafB was also detected in the early insulin-producing cells at E12.5, and expression persisted in glucagon- and insulin-producing cells throughout pancreas development (Fig. 5) but was not found in either somatostatin or pancreatic polypeptide cells (data not shown). These results establish that MafB is selectively produced in insulin+ and glucagon+ islet progenitor cells during pancreas development.
MafB becomes progressively restricted to -cells postnatally because expression in -cells is downregulated within 2 weeks of birth and is undetectable in these cells by 3 weeks (Fig. 5; data not shown). To further characterize the transition between differentiating insulin-producing cells (MafB+) and mature -cells (MafBeC), colocalization of MafB with Pdx1 was examined at E18.5 and P4. Pdx1 is principally expressed in insulin+ cells and not glucagon+ cells at these times (43). As expected, only a few Pdx1+MafB+ cells were detected (Fig. 6A). In contrast to the pancreas, MafB was expressed in essentially all Pdx1+ cells along the villi of the duodenum at P4 and at lower levels in many Pdx1+ cells in the duodenal crypts (Fig. 6A). This pattern indicates that MafB may also be contributing in the duodenum to transcription of large Maf-regulated genes like pdx1.
MafB is expressed in endocrine progenitor cells within the developing pancreas.
MafB expression was also detected in some surrounding noneChormone-expressing cells between E12.5 and E18.5 (data not shown), potentially representing the MafB+Neurogenin3+ islet progenitor cells detected by microarray analysis (44). Costaining of MafB and Neurogenin3+ (Ngn3+) supported this hypothesis because MafB was found in a fraction of the Ngn3+ cells at early endocrine differentiation stages (Fig. 6B). The presence of MafB in Ngn3+ cells, a transcription factor essential for the production of all islet cell types (45), suggests that MafB may be present in proliferating islet progenitor cells. Coexpression of MafB and ki67, a marker for dividing cells, was found in some MafB+ cells throughout development (Fig. 6C). At E13.5, the MafB+ki67+ cells are readily detectable, but these cells become less abundant at E15.5 and E18.5. Because glucagon and insulin are not expressed in replicating cells during pancreatogenesis (46,47), these observations suggest that MafB is expressed in both dividing and nondividing islet progenitor cells.
MafB expression is maintained in insulin- and glucagon-producing cells of Pax4- and Pax6-deficient animals.
To provide insight into when MafB acts during pancreatic development, expression was analyzed in Pax4- and Pax6-deficient mice. The vast majority of - and -cells (22) are lost in pax4 mutant mice, whereas glucagon- and insulin-producing cell numbers are severely reduced in both Pax6eC/eC (19,20) and Pax6 sey/sey (12) animals. The Pax6 sey/sey mutation prevents translation of a functional protein (38). MafB expression was observed in the insulin+ and glucagon+ cells remaining in Pax4 and Pax6 sey/sey mutants at E15.5 (Fig. 7), indicating that neither Pax4 nor Pax6 is required for MafB expression. These results may also indicate that MafB can participate in gene regulation early in - and -cell development, before Pax4 and Pax6 expression.
DISCUSSION
Large Maf proteins are involved in regulating the transcription of genes important to cell typeeCspecific expression and differentiation. MafA has been identified as a -celleCspecific activator of the insulin gene (28eC30) and was recently found to be critical to glucose-stimulated insulin secretion in vivo (33). In addition to MafA, the closely related MafB protein is also capable of activating insulin gene expression (28). In this study, we have shown that MafB can also specifically activate glucagon gene expression in cell culture-based assays and directly binds to the control region of the endogenous glucagon gene. In addition, MafB was coexpressed with insulin and glucagon during pancreatogenesis and in early replicating noneChormone-producing cells. Collectively, our data suggest that MafB may be involved in both - and -cell formation and islet -cell function.
Immunohistochemical analysis with the newly available peptide-specific antibody BL658 revealed that MafB is only present in islet -cells within the adult pancreas (Fig. 1). The previous detection of MafB in islet -cells most likely represents cross-reactivity with MafA (28). The unique presence of MafB in -cells strongly indicates a key role in -cell function. Our transfection and gel shift results strongly suggest that MafB activates glucagon gene expression through the G1 element at bp eC77 to eC51. However, c-Maf has also recently been proposed to stimulate glucagon expression (48). Because this suggestion was primarily based on studies in cell lines and due to our inability to detect c-Maf in islet cells (data not shown), we do not believe that this factor regulates glucagon expression in vivo. c-Maf mRNA levels are a small fraction of MafA (1 of 100) and MafB (1 of 50) in the islet (28). Presumably, the c-Maf mRNA present in islet samples (28) was either due to relatively low levels of expression in islet cells and/or due to contamination from blood cells present in these highly vascularized structures (37). Most significantly, MafB was shown to specifically bind to sequences associated with control of the endogenous glucagon gene in the islet -cell line, TC-6 (Fig. 2).
Adenoviral-mediated overexpression of MafB in TC-3 cells resulted in activation of endogenous glucagon gene expression (Table 1). Although commonly considered to represent a -cell line, TC-3 cells also express low levels of both glucagon and MafB. Strikingly, Ad-MafB failed to activate insulin and pdx1 in TC-3 cells, two large Maf protein target genes associated with -cell identity (49). This may indicate that large Maf protein activity is not limiting to transcription of these genes in this -cell line. In contrast to insulin or pdx1, glucagon is expressed very inefficiently in TC-3 cells and hence may be more sensitive to MafB-mediated activation. Similarly, glucagon expression was not induced by Ad-MafB in TC-6 cells, presumably because of high-level expression in this -cell line. On the other hand, the inability of MafB to activate -cell genes may reflect an unappreciated specificity of action between large Maf proteins, which are generally thought to be functionally interchangeable in vitro (28). Glucagon mRNA expression induced by Ad-MafB in TC-3 cells was also very low relative to -cells (data not shown), suggesting that other cell-enriched factors act together with MafB to stimulate high-level gene transcription (e.g., Brn4) (50). This proposal is consistent with both our inability to activate glucagon in either TC-6 or NIH3T3 cells (Table 1; data not shown) and the absence of glucagon in developing insulin+/MafB+ cells (Fig. 5).
During pancreas development, MafB was initially detected in glucagon+ cells by E10.5 and in insulin+ cells by E12.5 (Fig. 5). Interestingly, MafB becomes progressively restricted to -cells postnatally because expression in -cells is undetectable within 2 weeks of birth. Although it is unclear why MafB is lost in -cells during this time, this period coincides with profound morphological and physiological changes to islet cells. Thus, -, -, -, and pancreatic polypeptide cells arrange into the mature islet configuration, with -cells in the core and other cells at the periphery, and migrate away from ductal structures. In addition, and perhaps most importantly, the glucose responsiveness of -cells is established at this time (6).
The MafB expression pattern is unique because no other known pancreatic transcription factor is expressed in only - and -cell progenitors and then becomes restricted to -cells postnatally. In general, the transcription factors important to the islet can be grouped according to their expression pattern within the developing pancreas. Thus, such transcription factors have been found in early nonhormone progenitor cells (i.e., Ngn3), cells that produce each of the endocrine hormones (NeuroD1, Isl1, and Pax6) as well as in a specific hormone-producing cell type and its progenitors (Nkx6.1, Nkx2.2, Pax4, ARX, and Brn4) (51,52). However, none of these patterns apply to MafB or the closely related MafA transcription factor, which is only found in insulin-producing cells of the secondary transition and mature islet -cells (28,32). MafB was also the most highly expressed gene within the islet among the 27 found within the susceptibility locus for type 2 diabetes on human chromosome 20 (53). Significantly, the transient expression of MafB in differentiating and immature insulin-producing cells implies its likely involvement in regulation of genes important to -cell development, whereas the persistent presence in glucagon+ cells indicates a more fundamental role for MafB in islet -cells.
MafB and Ngn3 expression domains partially overlapped during early pancreas development (Fig. 5), possibly indicating that proliferating MafB+ cells represent MafB+/Ngn3+/hormoneeC progenitor cells (Fig. 8). This proposal is consistent with the essential but transient nature of Ngn3 in islet cell formation. In addition, the maintenance of expression in the insulin+ and glucagon+ cells of Pax4- and Pax6-deficient mice implies an early role in transcriptional regulation in both - and -cell development. Alternatively, MafB could act in parallel with Pax4 and Pax6 in developing - and -cells. Unfortunately, MafB-deficient mouse lines have not been examined for islet phenotypes (34), an analysis that will be essential for fully understanding the importance of MafB in - and -cell formation and function. Based on our observations, however, defects in the formation of both insulin+ and glucagon+ cells in the developing pancreas of these animals are predicted, as well as long-term deficiencies in proper regulation of glucose metabolism.
ACKNOWLEDGMENTS
R.S. has received National Institutes of Health Grant P01-DK-42502 and American Diabetes Association Grant 7-04-RA-116. B.S.-P. has received National Institutes of Health Grant U19-DK-42502 VUMC#9,183. I.A. has received Juvenile Diabetes Research Foundation Postdoctoral Grant 3-2003-579. L.E. has received support from the American Lebanese Syrian Associated Charities. Partial support was also provided to the Molecular Biology Core Laboratory by the Vanderbilt University Diabetes Research and Training Center (Public Health Service Grant P60-DK-20593).
The wild-type eC476 GLU reporter construct was a gift of Dr. Dan Drucker, goat anti-Pdx1 antibody was provided by Dr. C.V.E. Wright, and guinea pig anti-Ngn3 was obtained from Dr. M. Sander.
FOOTNOTES
I.A. and J.L. contributed equally to this study.
REFERENCES
Steiner DF, Bell GI, Rubenstein AH, Chan SJ: Chemistry and biosynthesis of the islet hormones: insulin, islet amyloid polypeptide (Amylin), glucagon, somatostatin, and pancreatic polypeptide. In Endocrinology. DeGroot LJ, Jameson JL, Eds. Philadelphia, Saunders, 2001, p.667eC696
Herrera PL, Huarte J, Sanvito F, Meda P, Orci L, Vassalli JD: Embryogenesis of the murine endocrine pancreas: early expression of pancreatic polypeptide gene. Development 113:1257eC1265, 1991
Teitelman G, Alpert S, Polak JM, Martinez A, Hanahan D: Precursor cells of mouse endocrine pancreas coexpress insulin, glucagon and the neuronal proteins tyrosine hydroxylase and neuropeptide Y, but not pancreatic polypeptide. Development 118:1031eC1039, 1993
Upchurch BH, Aponte GW, Leiter AB: Expression of peptide YY in all four islet cell types in the developing mouse pancreas suggests a common peptide YY-producing progenitor. Development 120:245eC252, 1994
Pictet RL, Clark WR, Williams RH, Rutter WJ: An ultrastructural analysis of the developing embryonic pancreas. Dev Biol 29:436eC467, 1972
Hole RL, Pian-Smith MC, Sharp GW: Development of the biphasic response to glucose in fetal and neonatal rat pancreas. Am J Physiol 254:E167eCE174, 1988
Leonard J, Peers B, Johnson T, Ferreri K, Lee S, Montminy MR: Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7:1275eC1283, 1993
Ohlsson H, Karlsson K, Edlund T: IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251eC4259, 1993
Miller CP, McGehee RE Jr, Habener JF: IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13:1145eC1156, 1994
Cissell MA, Zhao L, Sussel L, Henderson E, Stein R: Transcription factor occupancy of the insulin gene in vivo: evidence for direct regulation by Nkx2.2. J Biol Chem 278:751eC756, 2003
Ritz-Laser B, Estreicher A, Klages N, Saule S, Philippe J: Pax-6 and Cdx-2/3 interact to activate glucagon gene expression on the G1 control element. J Biol Chem 274:4124eC4132, 1999
Sander M, Neubuser A, Kalamaras J, Ee HC, Martin GR, German MS: Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development. Genes Dev 11:1662eC1673, 1997
Smith SB, Ee HC, Conners JR, German MS: Paired-homeodomain transcription factor PAX4 acts as a transcriptional repressor in early pancreatic development. Mol Cell Biol 19:8272eC8280, 1999
Fujitani Y, Kajimoto Y, Yasuda T, Matsuoka TA, Kaneto H, Umayahara Y, Fujita N, Watada H, Miyazaki JI, Yamasaki Y, Hori M: Identification of a portable repression domain and an E1A-responsive activation domain in Pax4: a possible role of Pax4 as a transcriptional repressor in the pancreas. Mol Cell Biol 19:8281eC8291, 1999
Naya FJ, Stellrecht CM, Tsai MJ: Tissue-specific regulation of the insulin gene by a novel basic helix-loop-helix transcription factor. Genes Dev 9:1009eC1019, 1995
Dumonteil E, Laser B, Constant I, Philippe J: Differential regulation of the glucagon and insulin I gene promoters by the basic helix-loop-helix transcription factors E47 and BETA2. J Biol Chem 273:19945eC19954, 1998
Ahlgren U, Jonsson J, Edlund H: The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development 122:1409eC1416, 1996
Offield MF, Jetton TL, Labosky PA, Ray M, Stein RW, Magnuson MA, Hogan BL, Wright CV: PDX-1 is required for pancreatic outgrowth and differentiation of the rostral duodenum. Development 122:983eC995, 1996
St-Onge L, Sosa-Pineda B, Chowdhury K, Mansouri A, Gruss P: Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature 387:406eC409, 1997
Ashery-Padan R, Zhou X, Marquardt T, Herrera P, Toube L, Berry A, Gruss P: Conditional inactivation of Pax6 in the pancreas causes early onset of diabetes. Dev Biol 269:479eC488, 2004
Wang J, Elghazi L, Parker SE, Kizilocak H, Asano M, Sussel L, Sosa-Pineda B: The concerted activities of Pax4 and Nkx2.2 are essential to initiate pancreatic beta-cell differentiation. Dev Biol 266:178eC189, 2004
Sosa-Pineda B, Chowdhury K, Torres M, Oliver G, Gruss P: The Pax4 gene is essential for differentiation of insulin-producing beta cells in the mammalian pancreas. Nature 386:399eC402, 1997
Naya FJ, Huang HP, Qiu Y, Mutoh H, DeMayo FJ, Leiter AB, Tsai MJ: Diabetes, defective pancreatic morphogenesis, and abnormal enteroendocrine differentiation in BETA2/neuroD-deficient mice. Genes Dev 11:2323eC2334, 1997
Stoffers DA, Ferrer J, Clarke WL, Habener JF: Early-onset type-II diabetes mellitus (MODY4) linked to IPF1. Nat Genet 17:138eC139, 1997
Yasuda T, Kajimoto Y, Fujitani Y, Watada H, Yamamoto S, Watarai T, Umayahara Y, Matsuhisa M, Gorogawa S, Kuwayama Y, Tano Y, Yamasaki Y, Hori M: PAX6 mutation as a genetic factor common to aniridia and glucose intolerance. Diabetes 51:224eC230, 2002
Malecki MT, Jhala US, Antonellis A, Fields L, Doria A, Orban T, Saad M, Warram JH, Montminy M, Krolewski AS: Mutations in NEUROD1 are associated with the development of type 2 diabetes mellitus. Nat Genet 23:323eC328, 1999
Kaneto H, Matsuoka TA, Nakatani Y, Miyatsuka T, Matsuhisa M, Hori M, Yamasaki Y: A crucial role of MafA as a novel therapeutic target for diabetes. J Biol Chem 280:15047eC15052, 2005
Matsuoka TA, Zhao L, Artner I, Jarrett HW, Friedman D, Means A, Stein R: Members of the large Maf transcription family regulate insulin gene transcription in islet beta cells. Mol Cell Biol 23:6049eC6062, 2003
Kataoka K, Han SI, Shioda S, Hirai M, Nishizawa M, Handa H: MafA is a glucose-regulated and pancreatic beta-cell-specific transcriptional activator for the insulin gene. J Biol Chem 277:49903eC49910, 2002
Olbrot M, Rud J, Moss LG, Sharma A: Identification of beta-cell-specific insulin gene transcription factor RIPE3b1 as mammalian MafA. Proc Natl Acad Sci U S A 99:6737eC6742, 2002
Zhao L, Guo M, Matsuoka TA, Hagman DK, Parazzoli SD, Poitout V, Stein R: The islet beta cell-enriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 280:11887eC11894, 2005
Matsuoka TA, Artner I, Henderson E, Means A, Sander M, Stein R: The MafA transcription factor appears to be responsible for tissue-specific expression of insulin. Proc Natl Acad Sci U S A 101:2930eC2933, 2004
Zhang C, Moriguchi T, Kajihara M, Esaki R, Harada A, Shimohata H, Oishi H, Hamada M, Morito N, Hasegawa K, Kudo T, Engel JD, Yamamoto M, Takahashi S: MafA is a key regulator of glucose-stimulated insulin secretion. Mol Cell Biol 25:4969eC4976, 2005
Blanchi B, Kelly LM, Viemari JC, Lafon I, Burnet H, Bevengut M, Tillmanns S, Daniel L, Graf T, Hilaire G, Sieweke MH: MafB deficiency causes defective respiratory rhythmogenesis and fatal central apnea at birth. Nat Neurosci 6:1091eC1100, 2003
Sadl VS, Sing A, Mar L, Jin F, Cordes SP: Analysis of hindbrain patterning defects caused by the kreisler(enu) mutation reveals multiple roles of Kreisler in hindbrain segmentation. Dev Dyn 227:134eC142, 2003
MacLean HE, Kim JI, Glimcher MJ, Wang J, Kronenberg HM, Glimcher LH: Absence of transcription factor c-maf causes abnormal terminal differentiation of hypertrophic chondrocytes during endochondral bone development. Dev Biol 262:51eC63, 2003
Cao S, Liu J, Chesi M, Bergsagel PL, Ho IC, Donnelly RP, Ma X: Differential regulation of IL-12 and IL-10 gene expression in macrophages by the basic leucine zipper transcription factor c-Maf fibrosarcoma. J Immunol 169:5715eC5725, 2002
Hill RE, Favor J, Hogan BL, Ton CC, Saunders GF, Hanson IM, Prosser J, Jordan T, Hastie ND, van Heyningen V: Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354:522eC525, 1991
Becker TC, Noel RJ, Coats WS, Gomez-Foix AM, Alam T, Gerard RD, Newgard CB: Use of recombinant adenovirus for metabolic engineering of mammalian cells. Methods Cell Biol 43:161eC189, 1994
Heller RS, Stoffers DA, Liu A, Schedl A, Crenshaw EB III, Madsen OD, Serup P: The role of Brn4/Pou3f4 and Pax6 in forming the pancreatic glucagon cell identity. Dev Biol 268:123eC134, 2004
Sakai M, Imaki J, Yoshida K, Ogata A, Matsushima-Hibaya Y, Kuboki Y, Nishizawa M, Nishi S: Rat maf related genes: specific expression in chondrocytes, lens and spinal cord. Oncogene 14:745eC750, 1997
Planque N, Leconte L, Coquelle FM, Benkhelifa S, Martin P, Felder-Schmittbuhl MP, Saule S: Interaction of Maf transcription factors with Pax-6 results in synergistic activation of the glucagon promoter. J Biol Chem 276:35751eC35760, 2001
Guz Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CV, Teitelman G: Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121:11eC18, 1995
Gu G, Wells JM, Dombkowski D, Preffer F, Aronow B, Melton DA: Global expression analysis of gene regulatory pathways during endocrine pancreatic development. Development 131:165eC179, 2004
Gradwohl G, Dierich A, LeMeur M, Guillemot F: neurogenin3 is required for the development of the four endocrine cell lineages of the pancreas. Proc Natl Acad Sci U S A 97:1607eC1611, 2000
Jensen J, Heller RS, Funder-Nielsen T, Pedersen EE, Lindsell C, Weinmaster G, Madsen OD, Serup P: Independent development of pancreatic - and -cells from neurogenin3-expressing precursors: a role for the notch pathway in repression of premature differentiation. Diabetes 49:163eC176, 2000
Schwitzgebel VM, Scheel DW, Conners JR, Kalamaras J, Lee JE, Anderson DJ, Sussel L, Johnson JD, German MS: Expression of neurogenin3 reveals an islet cell precursor population in the pancreas. Development 127:3533eC3542, 2000
Kataoka K, Shioda S, Ando K, Sakagami K, Handa H, Yasuda K: Differentially expressed Maf family transcription factors, c-Maf and MafA, activate glucagon and insulin gene expression in pancreatic islet alpha- and beta-cells. J Mol Endocrinol 32:9eC20, 2004
Samaras SE, Zhao L, Means A, Henderson E, Matsuoka TA, Stein R: The islet beta cell-enriched RIPE3b1/Maf transcription factor regulates pdx-1 expression. J Biol Chem 278:12263eC12270, 2003
Hussain MA, Miller CP, Habener JF: Brn-4 transcription factor expression targeted to the early developing mouse pancreas induces ectopic glucagon gene expression in insulin-producing beta cells. J Biol Chem 277:16028eC16032, 2002
Collombat P, Mansouri A, Hecksher-Sorensen J, Serup P, Krull J, Gradwohl G, Gruss P: Opposing actions of Arx and Pax4 in endocrine pancreas development. Genes Dev 17:2591eC2603, 2003
Wilson ME, Scheel D, German MS: Gene expression cascades in pancreatic development. Mech Dev 120:65eC80, 2003
Permutt MA, Wasson J, Love-Gregory L, Ma J, Skolnick G, Suarez B, Lin J, Glaser B: Searching for type 2 diabetes genes on chromosome 20. Diabetes 51 (Suppl. 3):S308eCS315, 2002(Isabella Artner, John Le )