Murine Gammaherpesvirus 68 Open Reading Frame 11 E
http://www.100md.com
病菌学杂志 2005年第5期
Division of Virology, Department of Pathology, University of Cambridge, Cambridge, United Kingdom
ABSTRACT
Open reading frame 11 (ORF11) is a conserved gammaherpesvirus gene that remains undefined. We identified the product of murine gammaherpesvirus 68 (MHV-68) ORF11, p43, as a virion component with a predominantly perinuclear distribution in infected cells. MHV-68 lacking p43 grew normally in vitro but showed reduced lytic replication in vivo and a delay in seeding to the spleen. Subsequent latency amplification was normal. Thus, MHV-68 ORF11 encoded a virion component that was important for in vivo lytic replication but dispensable for the establishment of latency.
TEXT
The gammaherpesviruses have probably colonized every mammalian species (11) and offer an object lesson in how to persist and remain infectious in a mammalian host. Gammaherpesvirus latency genes, particularly those of Epstein-Barr virus (EBV), have been analyzed in some detail. However, latency genes represent only a small fraction of each viral genome, most of which is devoted to lytic replication. The functions of many gammaherpesvirus-specific lytic genes are completely unknown. This is an important gap in our knowledge, since viral transmission depends on lytic gene expression, and without understanding transmission, it is difficult to develop optimal strategies of infection control.
The human gammaherpesviruses, EBV and the Kaposi's sarcoma-associated herpesvirus (KSHV), do not readily enter the lytic cycle in vitro and exhibit very narrow species tropisms in vivo. These limitations upon analysis have made murine gammaherpesvirus 68 (MHV-68), a gammaherpesvirus isolated from free-living rodents (3), a key experimental tool for understanding in vivo gammaherpesvirus gene functions (12, 13, 15). MHV-68 is closely related to KSHV (7, 16). Moreover, despite genetic divergence in latency genes among MHV-68, KSHV, and EBV, many lytic cycle genes show a high level of conservation among all three viruses. Consequently, the study of MHV-68 lytic genes has the potential to define features of in vivo pathogenesis that are broadly relevant to both human pathogens. Here we have addressed the role of MHV-68 open reading frame 11 (ORF11), which has homologs in both KSHV (ORF11) and EBV (Raji LF2).
MHV-68 ORF11 is a late gene (2, 6, 10). KSHV ORF11 has been placed in the kinetic class of primary lytic genes (8). We identified p43, the MHV-68 ORF11 gene product, as a component of virions, both as native protein and when fused to cyan-fluorescent protein (CFP). ORF11 was dispensable for viral lytic replication in vitro but contributed to lytic replication in vivo, implying a host interaction function. It was not required for the establishment of latency, consistent with the idea that this process is essentially independent of lytic replication.
Generation of ORF11-deficient viruses. We generated two ORF11 mutants using an MHV-68 bacterial artificial chromosome (BAC) (1) (Fig. 1A). First, we ligated the complementary oligonucleotides 5'GAGTGGCAGACCCTCTAGCTAGGATCCGAATTC and 5'GAATTCGGATCCTAGCTAGAGGGTCTGCCACTC into a blunted NcoI site (genomic coordinate 23503) in a HinDIII-I genomic clone (7). This ligation maintained the overlapping 3' end of ORF10 and introduced a translational stop site as the 14th amino acid residue of ORF11, as well as diagnostic EcoRI and BamHI restriction sites (underlined). The correct insert orientation was identified by DNA sequencing. Mutant ORF11 (ORF11–STOP) was subcloned into the pST76K-SR shuttle plasmid and recombined into MHV-68 BAC by established protocols (1). We caused the mutant BAC to revert (mutant REV) in a similar way, repairing the ORF11 locus with an unmutated HinDIII-I genomic clone. To make an independent mutant, we used RecE/T recombination to replace genomic coordinates 23548 to 23699 of the MHV-68 BAC with a kanamycin resistance gene (Kanr gene) flanked by flp recombinase target (FRT) sites. The Kanr gene was then excised by transient flp recombinase expression, to leave a single FRT site plus short, flanking plasmid sequences (166 bp in all). The residual insert included diagnostic EcoRI and SacI restriction sites and terminated normal ORF11 translation after 20 amino acid residues (ORF11–FRT). Southern blots (Fig. 1B) confirmed the predicted genomic structure of each virus.
Replication of ORF11-deficient viruses. Neither the ORF11–STOP nor the ORF11–FRT mutant showed an in vitro growth deficit (Fig. 2A to C). Thus, ORF11 was dispensable for viral lytic replication in both BHK-21 cells and murine embryo fibroblasts. In contrast, there was a small but significant lytic replication deficit after intranasal infection of mice (Fig. 2D). The initial seeding of latent virus to the spleen was also reduced (Fig. 2E, days 5 and 7), consistent with less lytic replication. However, latency amplification was unimpaired (Fig. 2E). This lack of impairment compensated for the seeding deficit and allowed the virus to achieve a normal latent load by day 10 of infection. The in vivo lytic replication deficit of the ORF11–STOP mutant was reproduced with two independently derived ORF11–FRT mutants (Fig. 2F) and in both C57BL/6J and BALB/c mice (Fig. 2G). A revertant of the ORF11–STOP mutant showed no significant replication deficit compared to the replication of the wild type (Fig. 2G).
Characterization of the ORF11 gene product. An ORF11-specific polyclonal serum was raised (Abcam, Cambridge, United Kingdom) by immunizing rabbits with amino acid residues 137 to 308 of ORF11 fused to glutathione S-transferase (GST). Immunoblotting of infected cell lysates with this serum identified a 43-kDa ORF11-specific band (p43) (Fig. 3A). The size of the band was consistent with the predicted size of the ORF11 gene product (42.5 kDa). We also tagged ORF11 in situ with CFP to give a predicted 70-kDa fusion protein. To do this, we used PCR to generate 1.2-kb genomic recombination flanks on either side of the 3' end of ORF11, inserting EcoRI and SalI restriction sites immediately upstream of the ORF11 stop codon. The CFP coding sequence was then cloned into these sites, thereby fusing CFP to the C-terminal lysine residue of ORF11 via a short linker. The ORF11-CFP fusion construct was recombined into a wild-type MHV-68 BAC by using the pST76K-SR shuttle plasmid, as described above. The ORF11-CFP virus showed no growth deficit in vitro (data not shown). Its BAC cassette GFP-coding sequence (1) was removed by viral passage through 3T3-CRE cells (14). Native and CFP-tagged p43 proteins were detectable in purified wild-type and ORF11-CFP virions, respectively (Fig. 3B). Since p43 is not predicted to be a component of the viral capsid and lacks a transmembrane domain, it is most likely to be a component of the MHV-68 tegument.
We confirmed that ORF11 lies within the virion envelope by trypsin digestion of purified virions (Fig. 3D and E). Wild-type and ORF11-CFP virions were treated or not treated with Triton X-100 to dissolve the virion membrane and then digested or not digested with trypsin. The virions were then immunoblotted for ORF11 or with an anti-MHV-68 serum (Fig. 3D). The anti-MHV-68 serum showed a substantial digestion of virion proteins by trypsin with or without Triton X-100, whereas ORF11 and ORF11-CFP were digested only when Triton X-100 was present. We then repeated this experiment with the ORF11-CFP virus and used an anti-GFP serum to detect ORF11. This process confirmed that ORF11-CFP was resistant to trypsin unless the virion membrane was first removed, whereas glycoprotein B (9) was digested regardless of whether the virion membrane was present or not.
Immunofluorescence with the anti-p43 serum showed ORF11-specific cytoplasmic staining (Fig. 4A and B). There was also nonspecific staining of some dead and dying cell nuclei (Fig. 4A). We used the ORF11-CFP virus as an independent means of localizing p43, without the complication of background staining (Fig. 4C to F). Unmodified GFP, expressed from the MHV-68 BAC cassette (1), showed a predominantly nuclear localization in infected cells (Fig. 4G and H). In contrast, ORF11-CFP was perinuclear. At 24 h postinfection, cyan fluorescence was concentrated in perinuclear spots (Fig. 4D and E). This appearance was consistent with the immunofluorescence data and presumably reflected p43 accumulating at sites of virion assembly. There was weaker cyan fluorescence on infected-cell surfaces, probably from p43 in mature virions that were attached to the outer surface of the plasma membrane (Fig. 4D). CFP spots that appeared to be within the nucleus (Fig. 4D) appeared to be within protrusions of the perinuclear space rather than the nuclear substance itself. The cyan fluorescence at 6 h postinfection (Fig. 4F) was relatively weak, consistent with ORF11 being a late gene of MHV-68, but was again perinuclear in distribution.
Speculation on p43 function. Virion tegument proteins such as p43 allow herpesviruses to modulate immediately the state of the newly infected host cell, before the viral genome reaches the nucleus. This modulation is crucial to the outcome of infection. The range of documented tegument protein functions is consequently extensive, and it is as yet unclear where p43 fits into this scheme. In vivo lytic replication, where ORF11 was important, clearly represents a more stringent test of viral fitness than replication in immortalized cell lines, where ORF11 was redundant. The in vitro-in vivo discrepancy suggested that p43 might have a host interaction function; possibilities include immune evasion, apoptosis inhibition, and promotion of DNA replication in quiescent cells. The importance of the last in viral pathogenesis is seen with MHV-68 thymidine kinase mutants, which show normal in vitro replication and a gross deficiency in in vivo replication (4).
A three- to fivefold decrease in lytic replication might seem rather insignificant for viral fitness, particularly with normal latency establishment. However, the key role for lytic replication probably lies not in primary infection but in reactivation from latency and transmission to new hosts. Despite viral immune evasion, host immunity leaves only a limited window for productive reactivation, so even a threefold reduction in lytic replication would severely reduce long-term infectivity. We are only just beginning to uncover the many host functions that complex viruses such as MHV-68 modulate to maximize the infectious particle yield.
ACKNOWLEDGMENTS
This work was supported by Medical Research Council grants G108/462 and G9800903 and project grant 059601 from the Wellcome Trust. P.G.S. is an MRC/Academy of Medical Sciences Clinician Scientist.
Present address: Division of Immunology, Department of Pathology, University of Cambridge, Cambridge, United Kingdom.
REFERENCES
Adler, H., M. Messerle, M. Wagner, and U. H. Koszinowski. 2000. Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J. Virol. 74:6964-6974.
Ahn, J. W., K. L. Powell, P. Kellam, and D. G. Alber. 2002. Gammaherpesvirus lytic gene expression as characterized by DNA array. J. Virol. 76:6244-6256.
Blaskovic, D., M. Stancekova, J. Svobodova, and J. Mistrikova. 1980. Isolation of five strains of herpesviruses from two species of free living small rodents. Acta Virol. 24:468.
Coleman, H. M., B. de Lima, V. Morton, and P. G. Stevenson. 2003. Murine gammaherpesvirus 68 lacking thymidine kinase shows severe attenuation of lytic cycle replication in vivo but still establishes latency. J. Virol. 77:2410-2417.
de Lima, B. D., J. S. May, and P. G. Stevenson. 2004. Murine gammaherpesvirus 68 lacking gp150 shows defective virion release but establishes normal latency in vivo. J. Virol. 78:5103-5112.
Ebrahimi, B., B. M. Dutia, K. L. Roberts, J. J. Garcia-Ramirez, P. Dickinson, J. P. Stewart, P. Ghazal, D. J. Roy, and A. A. Nash. 2003. Transcriptome profile of murine gammaherpesvirus-68 lytic infection. J. Gen. Virol. 84:99-109.
Efstathiou, S., Y. M. Ho, and A. C. Minson. 1990. Cloning and molecular characterization of the murine herpesvirus 68 genome. J. Gen. Virol. 71:1355-1364.
Jenner, R. G., M. M. Alba, C. Boshoff, and P. Kellam. 2001. Kaposi's sarcoma-associated herpesvirus latent and lytic gene expression as revealed by DNA arrays. J. Virol. 75:891-902.
Lopes, F. B., S. Colaco, J. S. May, and P. G. Stevenson. 2004. Characterization of the MHV-68 glycoprotein B. J. Virol. 78:13370-13375.
Martinez-Guzman, D., T. Rickabaugh, T. T. Wu, H. Brown, S. Cole, M. J. Song, L. Tong, and R. Sun. 2003. Transcription program of murine gammaherpesvirus 68. J. Virol. 77:10488-10503.
McGeoch, D. J. 2001. Molecular evolution of the gamma-Herpesvirinae. Philos. Trans. R. Soc. Lond. B 356:421-435.
Nash, A. A., and N. P. Sunil-Chandra. 1994. Interactions of the murine gammaherpesvirus with the immune system. Curr. Opin. Immunol. 6:560-563.
Speck, S. H., and H. W. Virgin. 1999. Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis. Curr. Opin. Microbiol. 2:403-409.
Stevenson, P. G., J. S. May, X. G. Smith, S. Marques, H. Adler, U. H. Koszinowski, J. P. Simas, and S. Efstathiou. 2002. K3-mediated evasion of CD8(+) T cells aids amplification of a latent gamma-herpesvirus. Nat. Immunol. 3:733-740.
Stevenson, P. G., J. M. Boname, B. de Lima, and S. Efstathiou. 2002. A battle for survival: immune control and immune evasion in murine gamma-herpesvirus-68 infection. Microbes Infect. 4:1177-1182.
Virgin, H. W., P. Latreille, P. Wamsley, K. Hallsworth, K. E. Weck, A. J. Dal Canto, and S. H. Speck. 1997. Complete sequence and genomic analysis of murine gammaherpesvirus 68. J. Virol. 71:5894-5904.(Jessica M. Boname, Janet )
ABSTRACT
Open reading frame 11 (ORF11) is a conserved gammaherpesvirus gene that remains undefined. We identified the product of murine gammaherpesvirus 68 (MHV-68) ORF11, p43, as a virion component with a predominantly perinuclear distribution in infected cells. MHV-68 lacking p43 grew normally in vitro but showed reduced lytic replication in vivo and a delay in seeding to the spleen. Subsequent latency amplification was normal. Thus, MHV-68 ORF11 encoded a virion component that was important for in vivo lytic replication but dispensable for the establishment of latency.
TEXT
The gammaherpesviruses have probably colonized every mammalian species (11) and offer an object lesson in how to persist and remain infectious in a mammalian host. Gammaherpesvirus latency genes, particularly those of Epstein-Barr virus (EBV), have been analyzed in some detail. However, latency genes represent only a small fraction of each viral genome, most of which is devoted to lytic replication. The functions of many gammaherpesvirus-specific lytic genes are completely unknown. This is an important gap in our knowledge, since viral transmission depends on lytic gene expression, and without understanding transmission, it is difficult to develop optimal strategies of infection control.
The human gammaherpesviruses, EBV and the Kaposi's sarcoma-associated herpesvirus (KSHV), do not readily enter the lytic cycle in vitro and exhibit very narrow species tropisms in vivo. These limitations upon analysis have made murine gammaherpesvirus 68 (MHV-68), a gammaherpesvirus isolated from free-living rodents (3), a key experimental tool for understanding in vivo gammaherpesvirus gene functions (12, 13, 15). MHV-68 is closely related to KSHV (7, 16). Moreover, despite genetic divergence in latency genes among MHV-68, KSHV, and EBV, many lytic cycle genes show a high level of conservation among all three viruses. Consequently, the study of MHV-68 lytic genes has the potential to define features of in vivo pathogenesis that are broadly relevant to both human pathogens. Here we have addressed the role of MHV-68 open reading frame 11 (ORF11), which has homologs in both KSHV (ORF11) and EBV (Raji LF2).
MHV-68 ORF11 is a late gene (2, 6, 10). KSHV ORF11 has been placed in the kinetic class of primary lytic genes (8). We identified p43, the MHV-68 ORF11 gene product, as a component of virions, both as native protein and when fused to cyan-fluorescent protein (CFP). ORF11 was dispensable for viral lytic replication in vitro but contributed to lytic replication in vivo, implying a host interaction function. It was not required for the establishment of latency, consistent with the idea that this process is essentially independent of lytic replication.
Generation of ORF11-deficient viruses. We generated two ORF11 mutants using an MHV-68 bacterial artificial chromosome (BAC) (1) (Fig. 1A). First, we ligated the complementary oligonucleotides 5'GAGTGGCAGACCCTCTAGCTAGGATCCGAATTC and 5'GAATTCGGATCCTAGCTAGAGGGTCTGCCACTC into a blunted NcoI site (genomic coordinate 23503) in a HinDIII-I genomic clone (7). This ligation maintained the overlapping 3' end of ORF10 and introduced a translational stop site as the 14th amino acid residue of ORF11, as well as diagnostic EcoRI and BamHI restriction sites (underlined). The correct insert orientation was identified by DNA sequencing. Mutant ORF11 (ORF11–STOP) was subcloned into the pST76K-SR shuttle plasmid and recombined into MHV-68 BAC by established protocols (1). We caused the mutant BAC to revert (mutant REV) in a similar way, repairing the ORF11 locus with an unmutated HinDIII-I genomic clone. To make an independent mutant, we used RecE/T recombination to replace genomic coordinates 23548 to 23699 of the MHV-68 BAC with a kanamycin resistance gene (Kanr gene) flanked by flp recombinase target (FRT) sites. The Kanr gene was then excised by transient flp recombinase expression, to leave a single FRT site plus short, flanking plasmid sequences (166 bp in all). The residual insert included diagnostic EcoRI and SacI restriction sites and terminated normal ORF11 translation after 20 amino acid residues (ORF11–FRT). Southern blots (Fig. 1B) confirmed the predicted genomic structure of each virus.
Replication of ORF11-deficient viruses. Neither the ORF11–STOP nor the ORF11–FRT mutant showed an in vitro growth deficit (Fig. 2A to C). Thus, ORF11 was dispensable for viral lytic replication in both BHK-21 cells and murine embryo fibroblasts. In contrast, there was a small but significant lytic replication deficit after intranasal infection of mice (Fig. 2D). The initial seeding of latent virus to the spleen was also reduced (Fig. 2E, days 5 and 7), consistent with less lytic replication. However, latency amplification was unimpaired (Fig. 2E). This lack of impairment compensated for the seeding deficit and allowed the virus to achieve a normal latent load by day 10 of infection. The in vivo lytic replication deficit of the ORF11–STOP mutant was reproduced with two independently derived ORF11–FRT mutants (Fig. 2F) and in both C57BL/6J and BALB/c mice (Fig. 2G). A revertant of the ORF11–STOP mutant showed no significant replication deficit compared to the replication of the wild type (Fig. 2G).
Characterization of the ORF11 gene product. An ORF11-specific polyclonal serum was raised (Abcam, Cambridge, United Kingdom) by immunizing rabbits with amino acid residues 137 to 308 of ORF11 fused to glutathione S-transferase (GST). Immunoblotting of infected cell lysates with this serum identified a 43-kDa ORF11-specific band (p43) (Fig. 3A). The size of the band was consistent with the predicted size of the ORF11 gene product (42.5 kDa). We also tagged ORF11 in situ with CFP to give a predicted 70-kDa fusion protein. To do this, we used PCR to generate 1.2-kb genomic recombination flanks on either side of the 3' end of ORF11, inserting EcoRI and SalI restriction sites immediately upstream of the ORF11 stop codon. The CFP coding sequence was then cloned into these sites, thereby fusing CFP to the C-terminal lysine residue of ORF11 via a short linker. The ORF11-CFP fusion construct was recombined into a wild-type MHV-68 BAC by using the pST76K-SR shuttle plasmid, as described above. The ORF11-CFP virus showed no growth deficit in vitro (data not shown). Its BAC cassette GFP-coding sequence (1) was removed by viral passage through 3T3-CRE cells (14). Native and CFP-tagged p43 proteins were detectable in purified wild-type and ORF11-CFP virions, respectively (Fig. 3B). Since p43 is not predicted to be a component of the viral capsid and lacks a transmembrane domain, it is most likely to be a component of the MHV-68 tegument.
We confirmed that ORF11 lies within the virion envelope by trypsin digestion of purified virions (Fig. 3D and E). Wild-type and ORF11-CFP virions were treated or not treated with Triton X-100 to dissolve the virion membrane and then digested or not digested with trypsin. The virions were then immunoblotted for ORF11 or with an anti-MHV-68 serum (Fig. 3D). The anti-MHV-68 serum showed a substantial digestion of virion proteins by trypsin with or without Triton X-100, whereas ORF11 and ORF11-CFP were digested only when Triton X-100 was present. We then repeated this experiment with the ORF11-CFP virus and used an anti-GFP serum to detect ORF11. This process confirmed that ORF11-CFP was resistant to trypsin unless the virion membrane was first removed, whereas glycoprotein B (9) was digested regardless of whether the virion membrane was present or not.
Immunofluorescence with the anti-p43 serum showed ORF11-specific cytoplasmic staining (Fig. 4A and B). There was also nonspecific staining of some dead and dying cell nuclei (Fig. 4A). We used the ORF11-CFP virus as an independent means of localizing p43, without the complication of background staining (Fig. 4C to F). Unmodified GFP, expressed from the MHV-68 BAC cassette (1), showed a predominantly nuclear localization in infected cells (Fig. 4G and H). In contrast, ORF11-CFP was perinuclear. At 24 h postinfection, cyan fluorescence was concentrated in perinuclear spots (Fig. 4D and E). This appearance was consistent with the immunofluorescence data and presumably reflected p43 accumulating at sites of virion assembly. There was weaker cyan fluorescence on infected-cell surfaces, probably from p43 in mature virions that were attached to the outer surface of the plasma membrane (Fig. 4D). CFP spots that appeared to be within the nucleus (Fig. 4D) appeared to be within protrusions of the perinuclear space rather than the nuclear substance itself. The cyan fluorescence at 6 h postinfection (Fig. 4F) was relatively weak, consistent with ORF11 being a late gene of MHV-68, but was again perinuclear in distribution.
Speculation on p43 function. Virion tegument proteins such as p43 allow herpesviruses to modulate immediately the state of the newly infected host cell, before the viral genome reaches the nucleus. This modulation is crucial to the outcome of infection. The range of documented tegument protein functions is consequently extensive, and it is as yet unclear where p43 fits into this scheme. In vivo lytic replication, where ORF11 was important, clearly represents a more stringent test of viral fitness than replication in immortalized cell lines, where ORF11 was redundant. The in vitro-in vivo discrepancy suggested that p43 might have a host interaction function; possibilities include immune evasion, apoptosis inhibition, and promotion of DNA replication in quiescent cells. The importance of the last in viral pathogenesis is seen with MHV-68 thymidine kinase mutants, which show normal in vitro replication and a gross deficiency in in vivo replication (4).
A three- to fivefold decrease in lytic replication might seem rather insignificant for viral fitness, particularly with normal latency establishment. However, the key role for lytic replication probably lies not in primary infection but in reactivation from latency and transmission to new hosts. Despite viral immune evasion, host immunity leaves only a limited window for productive reactivation, so even a threefold reduction in lytic replication would severely reduce long-term infectivity. We are only just beginning to uncover the many host functions that complex viruses such as MHV-68 modulate to maximize the infectious particle yield.
ACKNOWLEDGMENTS
This work was supported by Medical Research Council grants G108/462 and G9800903 and project grant 059601 from the Wellcome Trust. P.G.S. is an MRC/Academy of Medical Sciences Clinician Scientist.
Present address: Division of Immunology, Department of Pathology, University of Cambridge, Cambridge, United Kingdom.
REFERENCES
Adler, H., M. Messerle, M. Wagner, and U. H. Koszinowski. 2000. Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J. Virol. 74:6964-6974.
Ahn, J. W., K. L. Powell, P. Kellam, and D. G. Alber. 2002. Gammaherpesvirus lytic gene expression as characterized by DNA array. J. Virol. 76:6244-6256.
Blaskovic, D., M. Stancekova, J. Svobodova, and J. Mistrikova. 1980. Isolation of five strains of herpesviruses from two species of free living small rodents. Acta Virol. 24:468.
Coleman, H. M., B. de Lima, V. Morton, and P. G. Stevenson. 2003. Murine gammaherpesvirus 68 lacking thymidine kinase shows severe attenuation of lytic cycle replication in vivo but still establishes latency. J. Virol. 77:2410-2417.
de Lima, B. D., J. S. May, and P. G. Stevenson. 2004. Murine gammaherpesvirus 68 lacking gp150 shows defective virion release but establishes normal latency in vivo. J. Virol. 78:5103-5112.
Ebrahimi, B., B. M. Dutia, K. L. Roberts, J. J. Garcia-Ramirez, P. Dickinson, J. P. Stewart, P. Ghazal, D. J. Roy, and A. A. Nash. 2003. Transcriptome profile of murine gammaherpesvirus-68 lytic infection. J. Gen. Virol. 84:99-109.
Efstathiou, S., Y. M. Ho, and A. C. Minson. 1990. Cloning and molecular characterization of the murine herpesvirus 68 genome. J. Gen. Virol. 71:1355-1364.
Jenner, R. G., M. M. Alba, C. Boshoff, and P. Kellam. 2001. Kaposi's sarcoma-associated herpesvirus latent and lytic gene expression as revealed by DNA arrays. J. Virol. 75:891-902.
Lopes, F. B., S. Colaco, J. S. May, and P. G. Stevenson. 2004. Characterization of the MHV-68 glycoprotein B. J. Virol. 78:13370-13375.
Martinez-Guzman, D., T. Rickabaugh, T. T. Wu, H. Brown, S. Cole, M. J. Song, L. Tong, and R. Sun. 2003. Transcription program of murine gammaherpesvirus 68. J. Virol. 77:10488-10503.
McGeoch, D. J. 2001. Molecular evolution of the gamma-Herpesvirinae. Philos. Trans. R. Soc. Lond. B 356:421-435.
Nash, A. A., and N. P. Sunil-Chandra. 1994. Interactions of the murine gammaherpesvirus with the immune system. Curr. Opin. Immunol. 6:560-563.
Speck, S. H., and H. W. Virgin. 1999. Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis. Curr. Opin. Microbiol. 2:403-409.
Stevenson, P. G., J. S. May, X. G. Smith, S. Marques, H. Adler, U. H. Koszinowski, J. P. Simas, and S. Efstathiou. 2002. K3-mediated evasion of CD8(+) T cells aids amplification of a latent gamma-herpesvirus. Nat. Immunol. 3:733-740.
Stevenson, P. G., J. M. Boname, B. de Lima, and S. Efstathiou. 2002. A battle for survival: immune control and immune evasion in murine gamma-herpesvirus-68 infection. Microbes Infect. 4:1177-1182.
Virgin, H. W., P. Latreille, P. Wamsley, K. Hallsworth, K. E. Weck, A. J. Dal Canto, and S. H. Speck. 1997. Complete sequence and genomic analysis of murine gammaherpesvirus 68. J. Virol. 71:5894-5904.(Jessica M. Boname, Janet )